InformaçãoConceito

download report

Transcript InformaçãoConceito

O conceito de
informação em biomol
Prof. Dr. Francisco Prosdocimi
Os gregos
• Caos X Cosmos
– Cosmos = informação
• Ordem no universo pode ser
descrita e estudada
– A origem das ciências
– O sol nasce todos os dias
• Gregos eram teóricos
Informação
• O universo possui regras
• A ciência consiste na descoberta e
descrição dessas regras
• Isaac Newton (1687)
– Gravidade, aceleração, distância,
tempo
• O universo era finalmente
explicado
• Mas... E a biologia?
A hereditariedade
• Cadelas dão a luz a cachorrinhos
• Filhos se parecem com os pais
– Por que?
– Como isso acontece?
• O estudo da genética
(a partir de 1900)
2000 anos de hereditariedade
• Dos gregos ao século XVIII
– Preformacionistas X Epigeneticistas
– Naturalistas: filhos têm características de ambos os pais
• 1839; Schwann and Schleiden
– Célula como unidade básica da vida
– Fertilização
• Fim do século XIX
– Conhecimento sobre a
divisão celular
– Herança por mistura
Lamarck e Darwin
e Weismann
• Uma teoria evolutiva bem fundamentada precisa conter uma
teoria da hereditariedade
– Em que tipo de informação consiste a hereditariedade?
– Como ela é transmitida?
• Philosophie zoologique (1809)
– Herança dos caracteres adquiridos
– Informação biológica adquirida é herdada (hardwired)
• A origem das espécies (1859)
– Darwin era lamarckista?
• August Weismann (1888)
– Teoria do germoplasma
Mendel
• A Hereditariedade particulada (gene)
– Refutou a herança por mistura
• Publicou “Experimentos sobre a hibridização de plantas” em 1865 e
– foi citado apenas 3 vezes nos 35 anos que
se seguiram!
• Início do Século XX
Bateson, De Vries e Correns
Gregor Mendel (1822-1884)
O que é a vida?
• Fim do século XIX
– A morte do vitalismo
• Schrodinger, 1944: What’s life?
– Pag. 1: "how can the events in space and time
which take place within the spatial boundary of a
living organism [cell] be accounted for by physics
and chemistry?”
• O gene como uma molécula!
– Cristal aperiódico (carregador de informação)
– Watson diz achar a idéia maravilhosa
Erwin Schrodinger
(1887-1961)
Estrutura cristalina
• Conjunto de átomos arranjados
de uma forma particular
– Apresenta ordem e simetria
• A ordem é repetida
tridimensionalmente, formando
um arranjo químico ordenado e
repetitivo
• Schrodinger: DNA como cristal
aperiódico
– Deve carregar informação
Analógico X Digital
Informação digital
é medida em bits
O DNA como um código digital
•
A, C, G e T
– Pode ser representado como número em base 4
• 0, 1, 2 e 3
– Representação binária do DNA: 00, 01, 10, 11
•
1 byte são 8 bits
– Armazena 4 bases consecutivas
– 3,100,000,000 bases (genoma humano) =
775,000,000 bytes =
775 Megabytes
•
Windows XP = 1,5Gb
•
Código digital de quatro algarismos
– Guarda a informação sobre como fazer outro
indivíduo daquela espécie
•
Como um código digital pode estar codificado
quimicamente?
Watson & Crick
•
1952: primeiro encontro de Watson e Crick
– “Desde o dia de nosso primeiro encontro,
Crick e eu pensamos que seria altamente
provável que a informação genética do DNA
fosse codificada pela seqüência de quatro
bases”
•
Construção de um modelo molecular que
permitisse:
– Estabilidade estrutural
– Mecanismo de cópia
– Armazenamento de informação
•
A biologia finalmente tinha um modelo digital
para a transferência da informação hereditária
•
Agora seria possível estudar a biologia de maneira
precisa, matemática, estatísticas
– Era possível aplicar o rigor das ciências exatas ao
mundo natural
O modelo do DNA
> Meu gene
GGCTGCGGAGGACCGACCGTCCCCACGCCTGCCGCCCCGCGACCCCGACCGCCAGCATG
GCTCCTGGCCTATTACTTCACGGAGCTGAAGGATGACCAGGTCAAAAAGATTGACAAGT
ATGCGGCTCTCCGATGAAACTCTCATAGATATCATGACTCGCTTCAGGAAGGAGATGAA
CCCGGGATTTTAATCCAACAGCCACAGTCAAGATGTTGCCAACATTCGTAAGGTCCATT
TGAAAAGGGAGATTTCATTGCCCTGGATCTTGGTGGGTCTTCCTTTCGAATTCTGCGGG
Qual fita representamos
na bioinformática?
O leitor da Informação
•
Trouxe a informação de facto para o centro da discussão
– Propôs formas de ler e apresentar a informação biológica
•
Publica, em 1952, a primeira estrutura primária de uma
proteína (insulina)
– Prova que as proteínas poderiam ser descritas como
cadeias de aminoácidos
– 1958: ganha o Nobel em química
•
•
Frederick Sanger
13 August 1918
1975: inventa o método dideóxi para o sequenciamento do DNA
1977: sequencia, pela primeira vez, o genoma inteiro de um organismo, o
bacteriófago phi X 174
– 11 genes in 5386 bases
sequenciadas “à mão“
– Ganha o segundo Nobel de
química em 1980
A hereditariedade compreendida
• O código molecular da
hereditariedade está escrito
em letras químicas
– 4 letras: A, C, G e T
– (da mesma forma que o
código do português está
escrito em 23 letras + espaço)
– (e o código do computador,
em duas letras – 0 e 1)
O DNA como a receita da vida
• Repositório inalterável
da informação evolutiva
hereditária
• Quando faz-se um bolo,
mexe-se na receita?
A biologia molecular enquanto
cibernética
Cibernética
• Origem: Wikipédia, a enciclopédia livre.
•
Cibernética é uma tentativa de compreender
a comunicação e o controle de máquinas,
seres vivos e grupos sociais através de
analogias com as máquinas cibernéticas
(homeostatos, servomecanismos, etc.).
•
A Cibernética estuda o tratamento da
informação no interior de processos
cibernéticos como codificação e
descodificação, retroação ou realimentação
(feedback), aprendizagem, etc.
•
Segundo Wiener (1968), do ponto de vista da
transmissão da informação, a distinção entre
máquinas e seres vivos, humanos ou não, é
mera questão de semântica.
•
Cyborg = cybernetic organism
O gene egoísta, 1976
• Richard Dawkins
• Organismos biológicos como máquinas
de sobrevivência para os genes
– Apenas os melhores genes, capazes de
construir uma máquina de sobrevivência
para propagar sua informação de forma
eficiente, ganharão a corrida evolutiva
• A origem da vida através da molécula
replicadora
• Alto conteúdo empírico: explica o instinto
sexual, cuidado parental, nepotismo,
diferenças comportamentais entre
machos e fêmeas (teoria do investimento
parental),
• Baseados na concepção do gene como
unidade de informação que quer se
manter “viva” ao longo das eras
Conclusão
• A compreensão do código informacional para a
hereditariedade foi um processo lento de conhecimento
sobre as regularidades que regem o processo
• O DNA contém as informações sobre a hereditariedade
– Essas informações estão impressas em um código digital
• A sequência de bases químicas em um genoma (DNA) não é
disposta ao acaso e guarda a informação sobre como fazer
um determinado indivíduo daquela espécie
• Toda a vida consiste na reprodução de moléculas replicantes
com conteúdos informacionais