PowerPoint 프레젠테이션

download report

Transcript PowerPoint 프레젠테이션

유산균의 동정 및 김치 유산균의 다상 연구
한국생명공학연구원
생물자원센터
유전자은행
이정숙
Lactic acid bacteria
Gram-positive, non spore-forming, catalasenegative, devoid of cytochromes, of nonaerobic
habit but aerotolerant, fastioius, acid-tolerant,
cocci or rods, which produce lactic acid as a
major sole end product of the fermentation of
sugar
Consist of several genera including Aerococcus,
Alloiococcus, Carnobacterium, Dolosigranulum,
Enterococcus, Globicatella, Lactobacillus,
Lactococcus, Lactosphaera, Leuconostoc,
Oenococcus, Pediococcus, Streptococcus,
Tetragenococcus, Vagococcus, and Weissella
(16 genera)
The lactic acid bacteria are of paramount
importance in the food industry, both as beneficial
organisms and as spoilage organisms. They are
used in the production of fermented milk products
such as yogurt, sour cream, cheese and butter,
and in the production of sausage, pickles,
sauerkraut and kimchi. The results of these
fermentations are more shelf-stable products with
characteristic aromas and flavors. If the growth of
lactic acid bacteria is not in some way controlled,
they can be a major cause of food spoilage. The
souring of milk and the greening of meat are
common examples of spoilage resulting from the
unchecked activity of these organisms.
Differential characteristics of lactic acid bacteria
Rods
Cocci
Character
Carnob.
Lactob.
Aeroc.
Enteroc.
Lactoc.
Vagoc.
Leuconoc.
Oenoc.
Pedioc.
Streptoc.
Tetragenoc.
Weissella
Tetrad formation
-
-
+
-
-
-
+
-
+
-
CO2 from glucose
-
±
-
-
-
+
-
-
-
+
Growth at 10ºC
+
±
+
+
+
+
±
-
+
+
Growth at 45ºC
-
±
-
+
-
-
±
±
-
-
ND
±
+
+
-
±
±
-
+
±
-
-
-
-
-
-
-
-
+
-
Growth at pH 4.4
ND
±
-
+
±
±
+
-
-
±
Growth at pH 9.6
-
-
+
+
-
-
-
-
+
-
Lactic acid
L
D, L,
DL
L
L
L
D
L, DL
L
L
D, DL
Growth
NaCl
at
6.5%
Growth at 18% NaCl
Schematic, unrooted phylogenetic tree of the lactic acid bacteria, including
some aerobic and facultatively Gram-positives of the low G+C subdivision.
Note: evolutionary distances are approximate.
(Lactic Acid Bacteria: microbiology and functional aspects/ edited by Seppo
Salminen & Atte von Wright. 2nd ed.)
Lactic acid bacteria 분류, 동정의 문제점
동일한 선택 배지에서 생육이 가능하며 생리생화학적 특
성에 따른 명확한 구분이 어렵다.
16S rRNA sequence 분석을 통한 분자분류학적 연구 결
과로부터 genus간의 혼재되는 양상이 보고되었고, 새로운
genus로의 전이가 진행중이다.
분류학 연구의 목적

기존의 미생물 분류체계 확립

분리균의 정확한 동정

새로운 유용한 미생물의 발견
Bacterial systematics 의 최근 동향

Polyphasic taxonomy

분자계통분류 (Molecular systematics)

신속 동정

재분류

새로운 유용한 유전자의 응용
Type of modern bacterial systematics
Numerical taxonomy
Phenotypic data
Molecular
systematics
Nucleic acid sequencing
RFLP
RAPD
Chemotaxonomy
Protein analysis
Cell wall composition
Whole-organism
fingerprinting
Molecular systematic and Chemosystematic analyses of the bacteria cell,
and the taxonomic level at which they are generally most useful
Cell components
Analyses & Methods
Chromosomal DNA
Base composition(mol% G+C)
DNA:DNA hybridsation
DNA restriction patterns
rRNA RFLP(ribotyping)
Genus
Species
Ribosomal RNA
Nucleotide sequence
DNA:rRNA hybridsation
Species and subspecies
Protein
Amino acid sequence
Serological comparisons
Electrophoretic patterns
Cell walls and membranes
Peptidoglycan structure
Polysaccharides
Teichoic acids
Fatty acids
Polar lipids
Mycolic acids
Isoprenoid quinones
Taxonomic ranks covered
Species and subspecies
Genus and above
Species and genus
Genus and species
Species and subspecies
Genus and species
Metabolic produces
Fatty acids
Species and subspecies
Complete cell
Pyrolysis mass-spectrometry
Rapid enzyme tests
Genus, species and below
Species and subspecies
( modified from Priest and Austin, 1993)
분자계통분류

환경적 요인에 영향을 받지 않음

많은 세균의 재분류의 기반 조성

종 (species) 을 정의
세균 분류학에서의 종 (species)이란?


분류학에서의 정의가 가능한 기본 단위
DNA-DNA 상동성이 70% 이상인 균주들
(70% 이하일 경우 다른 종)
- 1987 국제세균분류위원회
*16S rRNA gene 상동성 97% 이하  DNA-DNA 상동
성이 60% 이하  다른 종
(Stackebrandt & Goebel, 1994)
새로운 유전자의 필요성

16S rRNA gene 및 DNA-DNA 상동성의 단점
- 16S rRNA gene
: 유연관계가 가까운 균주의 비교에는 적당치 않음
- DNA-DNA 상동성
: 실험상의 어려움

다른 유전자가 새로운 정보를 줄 수도 있음
16S rRNA gene in molecular systematics



모든 세균에 존재
염기서열의 variable region과 conserved
region의 분산 존재
많은 균주의 염기서열이 결정되어 있음
Chemotaxonomy
분석기기
발달
컴퓨터
발달
균체지방산 조성 분석
- 세포 지질의 필수 구성성분으로 모든 미생물에 존재
- 10 - 24개 정도의 carbon chain으로 이루어져 있으며 그들의 길이, 이중결합의 위치,
치환기 등에 따라 다양한 형태로 존재
- 최근에는 Microbial Identification System (MIDI; Microbial ID, Inc., Newark,
Del., USA) 이라는 Automated Gas Chromatography로 분석
Fatty acids found in bacteria.
HARVESTING
Third Quadrant
4mm Loop
Coat Bottom
SAPONIFICATION
Add 1.0 ml
Reagent # 1
100 ° C 5 min
Vortex
5-10 sec
Vortex
5-10 sec
100 ° C
25 min cool
METHYLATION
Add 2.0 ml
Reagent # 2
80 ± 1 ° C , 10 ±
1 minCool apidly
Vortex 5-10 sec
EXTRACTION
Add1.25 ml
Reagent # 3
10 min
Remove Bottom
Phase
Save Top Phase
WASH
Add 3.0 ml
Reagent # 4
5 min
Remove 2/3
Top Phase
Transfer to
GC Vial
Cap
95개 탄소원 이용성 분석 (BIOLOG system)
95개의 탄소원 이용성을 분석하여 미생물의 동정과 분류에 응용하는 자
동화 시스템
Biolog GP microplate
water
αcyclodextrin
βcyclodextrin
dextirn
glycogen
inulin
mannan
tween 40
tween 80
N-acetyl-Dglucosamin
e
N-acetyl-Dmannosami
ne
amygdalin
L-arabinose
D-arbitol
arbutin
cellobiose
D-fructose
L-fucose
D-galactose
Dgalacturonic
acid
gentiobiose
D-gluconic
acid
α-D-glucose
m-inositol
α-D-lactose
lactulose
maltose
maltotriose
D-mannitol
D-manose
Dmelezitose
D-melibiose
α-methyl Dgalactoside
β-methyl Dgalactoside
3-methyl
glucose
α-methyl Dglucoside
β-methyl Dglucoside
α-methyl Dmannoside
palatinose
D-psicose
D-raffinose
L-rhamnose
D-ribose
salicin
sedoheptulo
san
D-sorbitol
stachyose
sucrose
D-tagalose
D-trehalose
turanose
xylitol
D-sylose
acetic acid
αhydroxybuty
ric acid
βhydroxybuty
ric acid
γhydroxybuty
ric acid
ρhydroxyphe
nyl acetic
acid
α-keto
glutaric acid
α-keto
valeric acid
lactamide
D-lactic acid
methylester
L-lactic acid
D-malic acid
L-malic acid
methyl
pyruvate
monomethyl
succinate
propionic
acid
pyruvic acid
succinamic
acid
succinic
acid
N-acetyl Lglutamic
acid
alaninamide
D-alanine
L-alanine
L-alanylglycine
Lasparagine
L-glutamic
acid
glycyl-Lglutamic
acid
Lpyroglutami
c acid
L-serine
putrescine
2,3butanediol
glycerol
adenosine
2'-deoxy
adenosine
inosine
thymidine
uridine
adenosine5'monophosp
hate
tymidine-5'monophosp
hate
uridine-5'monophosp
hate
fructose-6phosphate
glucose-1'phosphate
glucose-6phosphate
D-L-αglycerol
phosphate
DNA 염기 조성 분석
DNA 염기 조성은
• mol % G+C로 표기
• 미생물의 전체 DNA 염기 조성에서 Guanine (G)과 Cytosine
(C)이 차지하는 상대적 비율을 나타내며 미생물마다 고유의 조성을
가짐
• 미생물의 속 (genus)과 종 (species)을 기술하는 최소 요건 중
하나로 이용
•세균의 DNA 염기조성의 차이 : 24 - 76 mol %
•분석 방법 : Tm법, Bd법, HPLC법
•G+C mol % 차이
5% 이상 : 다른 종
10% 이상 : 다른 속
G+C content of taxa taken to represent the main
lines of descent of procaryotes
Weissella koreensis sp. nov.,
isolated from kimchi
Morphological and physiological characteristics
irregular short or coccoid rods
Gram-positive, catalase-negative and facultative anaerobes
grew at 10 and 37 C but not at 42 C (optimum temperature : 25 C)
grew at pH 4.0-8.0 (optimum pH : pH 6.0)
Chemotaxonomic characteristics
Cell wall type : Lys-Ala-Ser
Major whole-cell fatty acids : octadecenoic acid (18:1) and hexadecanoic acid (16:0)
DNA base compositions : 37 mol%
DNA-DNA reassociation analysis
Phylogenetic analysis
Differential Characteristics of species of the genus Weissella.
W. kandleri*
W. viridescens*
W. minor*
W.
halotolerans*
W. confusa*
W.
paramesenteroi
des*
W. hellenica*
W.
thailandensis*
S-5623T
S-5673
L-Arabinose
-
-
-
-
-
d
+
+
+
+
Cellobiose
-
-
+
-
+
(d)
-
-
-
-
Galactose
+
-
-
-
+
+
-
+
-
-
Maltose
-
+
+
+
+
+
+
+
-
-
Melibiose
-
-
-
-
-
+
-
+
-
-
Raffinose
-
-
-
-
-
d
-
+
-
-
Ribose
+
-
+
+
+
d
-
+
+
+
Sucrose
-
d
+
-
+
+
+
+
-
-
Trehalose
-
d
+
-
-
+
+
+
-
-
Xylose
-
-
-
-
+
d
-
-
+
+
Hydrolysis esculin
-
-
+
-
+
(+)
ND
+
-
-
NH3 from arginine
+
-
+
+
+
-
-
-
+
+
Dextran formation
+
ND
-
ND
+
-
-
-
+
+
Lactic acid
configuration
DL
DL
DL
DL
DL
D
D
D
D
D
Murein type
Lys-Ala-GlyAla2
Lys-Ala-Ser
Lys-Ser-Ala2
Lys-Ala-Ser
Lys-Ala
Lys-Ala;
Lys-Ser-Ala2
Lys-Ala-Ser
Lys-Ala2
Lys-Ala-Ser
Lys-Ala-Ser
Cell Morphology
Irregular rods
Small irregular
rods
Irregular short
coccoid rods
with rounded to
tapered ends
Irregular short
or coccoid rods
Short rods
thickened at
one end
Spherical or
lenticular cells
Large spherical
or lenticular
cells
Cocci in pairs
or in chains
Irregular short
or coccoid rods
Irregular short
or coccoid rods
39
41-44
44
45
45-47
37-38
39-40
38-41
37
37
Characteristic
Acid produced from:
G + C content (mol%)
Scanning electron micrograph of strain S-5623T. Bar, 1m.
970
990
Leuconostoc argentinum DSM 8581T (AF175403)
Leuconostoc lactis JCM 6123T (AB023968)
Leuconostoc citreum KCTC 3526T (AF111948)
712
Leuconostoc kimchii KCTC 3286T (1F173986)
930
Leuconostoc gelidum DSM 5578T (AF175402)
Leuconostoc carnosum NCFB 2776T (X95977)
1000
Leuconostoc mesenteroides subsp. cremoris DSM 20346T (M23034)
1000
934
Leuconostoc mesenteroides subsp. mesenteroides DSM 20343T (M23035)
Leuconostoc pseudomesenteroides NCDO 768T (X95979)
Leuconostoc fallax DSM 20189T (S63851)
Oenococcus oeni ATCC 23279T (M35820)
998
Weissella paramesenteroides DSM 20288T (M23033)
Weissella thailandensis FS61-1T (AB023838)
976
Weissella hellenica NSFB 2973T (X95981)
Weissella confusa DSM 20196T (M23036)
1000
1000
Weissella minor DSM 20014T (M23039)
Weissella viridescens DSM 20410T (M23040)
Weissella halotolerans DSM 20190T (M23037)
1000
992
Weissella koreensis S5673 (AY035892)
Weissella koreensis S5623T (AY035891)
Weissella kandleri DSM 20593T (M23038)
Lactobacillus kimchii KCTC 8903PT (AF183558)
Lactobacillus .plantarum NCDO 1753T (X52653)
828
999
928
Lactobacillus brevis ATCC 14869T (M58810)
Lactobacillus delbrueckii subsp. delbtueckii ATCC 9649T (M58814)
Escherichia coli (V00348)
0.1
Phylogenetic relationships between Weissella koreensis S5623T, S5673, Weissella
species and other related bacteria based on 16S rDNA sequences. The branching
pattern was generated by the neighbour-joining method. The numbers indicate
bootstrap values > 700. The scale bar indicates 0.1 nucleotide substitutions per
nucleotide position.
DNA-DNA reassociation values between S-5623T, S-5673, W. kandleri
KCTC 3610T and W. viridescens KCTC 3504 T.
Species
% Reassociation with labeled DNA from:
S-5673
S-5623T
KCTC
3610T
KCTC
3504T
S-5673
100
103
25
16
S-5623T
90
100
24
16
W. Kandleri KCTC 3610T
21
20
100
14
W. viridescens
3504T
13
16
9
100
KCTC
Description of Weissella koreensis sp. nov. Weissella koreensis (ko.re.ensis
N. L. adj. koreensis, for Korea, which the new organisms were isolated)
Cells are irregular short rod-shaped or coccoid organism. Gram-positive, non-motile,
non-spore-forming, catalase-negative and facultative anaerobes. Grows at 10 and 37 C
and pH 4.0-8.0 but not at 42C. The optimum temperature and pH for growth were 25C
and 6.0, respectively. They did not grow in 8% and 10% NaCl. Arginine is hyrolysed and
dextran from sucrose is formed. D(-)-lactic acid and gas from glucose are produced. Acid
is produced from L-arabinose, ribose and xylose, but not from cellobiose, galactose,
maltose, melibiose, raffinose, sucrose and trehalose.
The G+C content of the DNA is 37 mol %. Lys-Ala-Ser in the cell walls. Major cellular fatty
acids are C18:1 7c and C16:0.
Source: kimchi, Korean traditional fermented vegetable food.
The type strain is S-5623T (= KCTC 3621T = KCCM 41516T = JCM 11263T), and reference
strain includes S-5673 (= KCTC 3622 = KCCM 41517 = JCM 11264).
Polyphasic Study for Monitoring
of the Lactic Acid Bacterial
Communities during Kimchi
Fermentation
연구의 목적
•김치 발효 과정에서의 젖산균의 다양성과 변화 분석
•김치유래 젖산균의 분류•동정
Culture-dependent approach for
diversity and dynamics of the microbial
communities during kimchi
fermentation
Analysis of FAMEs of isolates from MRS medium
A great diversity of fatty acid, at least 37 different ones, was detected in the isolates from
kimchi, but 15 of them appeared in less than 5% of the strains tested and will not be
considered in detail further.
Four fatty acids such as C14:0, C16:0, C18:1 ω9c, and summed feature 7 appeared in all strains
tested. Four fatty acids such as C16:1 ω7c, C18:0, C19:0 CYCLO ω8c, and Summed feature 9
appeared in more than 70% of the strains tested.
Cluster analysis revealed 7 major FANE clusters and 1 single cluster that are presented in an
abridged dendrogram. The clusters defined at Euclidian distance of 17.5.
Analysis of FAMEs of isolates from PES medium
The fatty acid compositions of the 79 presumptive Leuconostoc strains were determined.
Three of the 28 different fatty acid types were excluded from the final data analysis since
these were detected in less than 5% of the strains
All 79 strains contained C14:0, C16:0, C18:0, C18:1 ω9c, summed feature 4, and summed feature 7.
Seven fatty acids such as C15:0, C16:1 ω5c, C17:1 ω8c, C19:1 iso, C19:0 CYCLO ω8c, summed
feature 6, and summed feature 9 appeared in more than 70% of the strains tested.
All 79 strains were identified to known clusters, i.e. B, C and D, at a Euclidian distance of 17.5.
Euclidian distance
30.00
20.00
10.00
0.00
Cluste
r
Number of strains
A
6
B
61
C
79
Identity
Leu. mesenteroides subsp.
dextranicum
Leuconostoc sp.
Leu. citreum
Leu. pseudomesenteroides
G
8
Lab. delbruekii subsp. delbruekii
Lab. casei
F
28
Lab. plantarum
Lab. parabuchneri
Lab. plantarum
E
F
21
H
1
Lab. animalis
Lab. brevis
Leuconostoc sp.
Leu. mesenteroides subsp.
mesenteroides
D
24
Leu. mesenteroides subsp.
cremoris
Leu. carnosum
Leu. lactis
Dendrogram showing the relationship between the isolates from MRS medium based
on their cellular fatty acid profiles.
Analysis of carbon-source utilization patterns of isolates from MRS medium
The test strains were recovered in five major, one minor and twelve single clusters defined at
the SSM level of 80%.
Analysis of carbon-source utilization patterns of isolates from PES medium
All 75 strains were identified to known clusters, i.e. M, N, O and P, at the SSM level of 80%.
Percentage Similarity
50
60
70
80
Cluster
90
Number of
strains
Identity
100
R
2
Lactobacillus sp.
M
54
Leu. ameliobiosum
N
59
Leu. m. mesenteroides
Q
20
Lab. plantarum
Lab. d. delbrueckii
Lab. casei
S5386
O
25
S3
S136
S5486
S185
S176 P
11
KCTC3526
S123-2
S178
S5299
S199
S5393
Leuconostoc sp.
Leu. pseudomesenteroides
Leu. lactis
Lab. animalis
Lab. brevis
Lab. parabuchneri
Leuconostoc sp.
Leuconostoc sp.
Lactobacillus sp.
Leu. citreum
Leuconostoc sp.
Abridged dendrogram showing the relationships between the isolates from MRS medium
defined in the SSM, UPGMA analysis.
1.
균체지방산 조성 분석이나 탄소원 이용성 분석에 따라 lactic acid bacteria의
그룹화가 이루어지며, 이에 따른 데이터베이스를 구축할 수 있다. 그리고 분리
균주를 각각의 데이터베이스와 비교하여 분류하는 것도 가능하다.
2.
그러나, 두가지 방법에 따른 데이터베이스 상호간의 일치점을 명확히 규명하기
는 어렵다.
3.
Culture-dependent methods의 한계점을 극복할만한 새로운 측면의 연구 방
법 모색이 필요하다.
Molecular monitoring for diversity and
dynamics of the microbial communities
during kimchi fermentation
Denaturing Gradient Gel Electrophoresis (DGGE)
DGGE is based on the principle that increasing denaturant
concentration will melt double-stranded DNA in distinct domains.
When the melting temperature (Tm) of the lowest domain is
reached, the DNA will partially melt, creating branched molecules
with reduced mobility in a polyacrylamide gel. The denaturing
environment is created by a uniform run temperature between 50
and 65C and a linear denaturant gradient formed with urea and
formamide. The gradient may be formed perpendicular or parallel
to the direction of electrophoresis. DGGE is one of the most
sensitive mutation detection methods, providing efficiency up to
99%. Based on this principle, DGGE is used to be a suitable tool
for the study of microbial diversity.
Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular
to the electrophoresis direction.
This shows a single melting domain. At low denaturant concentration (left) the DNA
fragment remains double stranded, but as the concentration increases (moving right) the
DNA fragment begins to melt, creating a branched molecule. At very high concentrations,
the DNA fragment can completely melt, creating two single strands. (Upper)
A, Perpendicular denaturing gradient gel in which the denaturing gradient is
perpendicular to the electrophoresis direction. B, Parallel denaturing gradient gel in
which gradient is parallel to the electrophoresis direction. lane 1, mutant fragment; lane 2,
wild-type fragment; lane 3, mutant and wild-type fragments. (lower)
방법
Isolation of DNA
PCR-DGGE analysis
•Primer set (gc338f/518r)
•PCR condition (“touchdown” PCR)
•8% (wt/vol) polyacrylamide gels in 1X TAE
•denaturing gradient ranging from 10% to 50% urea-formamide
denaturing gradient (with 100% defined as 7 M urea and 40% [vol/vol]
formamide)
•gel electrophoresis : 16 h at 60 V
•Staining : SYBR Green I (Sigma Co., St. Louis, MS) for 30 min
Sequencing of DGGE fragments
Analysis of the sequence data
16S rRNA-targeted PCR primers used in this study.
Primer
Sequence (5’-3’)
Position
Reference
338f
518r
ACT CCT ACG GGA GGC AGC AG
ATT ACC GCG GCT GCT GG
357-338
534-518
Lane, D. J. (1991)
Muyzer, A. E. et al.
(1993)
A GC clamp was attached to the 5’ end of primer 338f to obtain primer gc338f (GC clamp,
5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGCACGGGGGG). Muyzer, A. E. et al. (1993)
PCR product obtained from amplification of chromosomal DNA
with gc338f/518r primer set
200bp
A
days
0
1
4
5
6
8
11
14
17
20
26
30
Weissella confusa group
Leuconostoc citreum
Lactobacillus sakei
Lactobacillus curbatus
Leuconostoc gelidium
B
days
0
1
2
3
5
6
8
10
14
18
20
Weissella confusa group
Leuconostoc citreum
Leuconostoc gelidium
Lactobacillus sakei
Lactobacillus curbatus
Lactococcus lactis subsp. lactis
DGGE analysis of PCR-amplified 16S rDNA fragments of microbial communities from kimchi fermented at 10C (A)
and 20C (B).
DGGE profiles from LAB reference strains and kimchi samples.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
a
b
c
d
e
f
g
Lanes: 1, Weissella confusa KCTC 3499T; 2, kimchi sample for 26 days at 10C; 3, kimchi sample for 18 days at
20C; 4, Leuconostoc citreum KCTC 3526T; 5, Leuconostoc gasicomotatum KCTC 3752T; 6, Leuconostoc
gelidium KCTC 3527T; 7, Leuconostoc pseudomesenteroides KCTC 3652T; 8, Leuconostoc mesenteroides subsp.
mesenteroides KCTC 3505T; 9, Leuconostoc mesenteroides subsp. dextranicum KCTC 3530T; 10, Leuconostoc
mesenteroides subsp. cremoris KCTC 3529T; 11, Lactobacillus brevis KCTC 3498T; 12, Lactobacillus curvatus
KCTC 3767T; 13, Lactobacillus sakei KCTC 3603T; 14, Lactobacillus plantarum KCTC 3108T; 15, Lactobacillus
fermentum KCTC 3112T; 16, Lactococcus lactis subsp. lactis KCTC 3769T.
Conclusion
main microorganisms for kimchi fermentation in DGGE analysis
Weissella confusa group (Weissella cibaria, Weissella
confusa and Weissella kimchii), Leuconostoc citreum,
Lactobacillus curvatus, and Lactobacillus sakei
• We demonstrated that the ecology of kimchi cannot be
effectively studied by cultivation-dependent methods alone,
because some of dominating taxa, although culturable, are
not recovered by this traditional approach.
• A polyphasic approach should allow us to better understand
the dynamic changes during kimchi fermentation.