share and download study presentations
Upload
Log In
Login
Register

Directory

Related presentations

Koalaty Kid Training - Cedar Rapids Community School District
Koalaty Kid Training - Cedar Rapids Community School District
Slide 1
Slide 1
Four Basic Design Principles - Coastal Carolina University
Four Basic Design Principles - Coastal Carolina University
The Baldrige Model of Excellence - CRCSD
The Baldrige Model of Excellence - CRCSD
Board Chair Workshop
Board Chair Workshop
Introduction to Design
Introduction to Design
Work Process Management - America Needs Baldrige!
Work Process Management - America Needs Baldrige!
Pre-AP – AP Vertical Alignment TSSSA 2011
Pre-AP – AP Vertical Alignment TSSSA 2011
Here - English 112: Writing Like an Expert
Here - English 112: Writing Like an Expert
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition Given two strings  x = x1x2...xM,  y = y1y2…yN,  an alignment is an assignment of gaps to positions 0,…, N in.
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition Given two strings x = x1x2...xM, y = y1y2…yN, an alignment is an assignment of gaps to positions 0,…, N in.
Multiple Sequence Alignments  CS262 Lecture 14, Win07, Batzoglou Progressive Alignment pxy pxyzw  x y z  pzw  w •  When evolutionary tree is known:  Align closest first, in the order of the.
Multiple Sequence Alignments CS262 Lecture 14, Win07, Batzoglou Progressive Alignment pxy pxyzw x y z pzw w • When evolutionary tree is known:  Align closest first, in the order of the.
Slides
Slides

Welcome to CS262: Computational Genomics Instructor: Serafim Batzoglou TAs: Eugene Davydov Christina Pop email: [email protected] Monday & Wednesday 11:50-1:05 James H Clark Center S361 http://cs262.stanford.edu.

Download Report

Transcript Welcome to CS262: Computational Genomics Instructor: Serafim Batzoglou TAs: Eugene Davydov Christina Pop email: [email protected] Monday & Wednesday 11:50-1:05 James H Clark Center S361 http://cs262.stanford.edu.


        	
  • Company
  • Nicosia Constantinou Palaiologou 16, Palouriotissa, 1040
  • +357 64-733-402
  • [email protected]
  • Links
  • About
  • Contact
  • Help / FAQ
  • Legal
  • Terms of Service
  • Privacy policy
  • Cookie policy
  • Disclaimer

slideum.com © 2026, Inc. All rights reserved.

Directory