Transcript Slides
CS 5263 Bioinformatics Lecture 3: Dynamic Programming and Global Sequence Alignment Evolution at the DNA level C …ACGGTGCAGTCACCA… …ACGTTGC-GTCCACCA… DNA evolutionary events (sequence edits): Mutation, deletion, insertion Sequence conservation implies function next generation OK OK OK X X Still OK? Why sequence alignment? • Conserved regions are more likely to be functional – Can be used for finding genes, regulatory elements, etc. • Similar sequences often have similar origin and function – Can be used to predict functions for new genes / proteins • Sequence alignment is one of the most widely used computational tools in biology Global Sequence Alignment S T S’ T’ AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition An alignment of two strings S, T is a pair of strings S’, T’ (with spaces) s.t. (1) |S’| = |T’|, and (|S| = “length of S”) (2) removing all spaces in S’, T’ leaves S, T What is a good alignment? Alignment: The “best” way to match the letters of one sequence with those of the other How do we define “best”? S’: -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--T’: TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC • The score of aligning (characters or spaces) x & y is σ (x,y). • Score of an alignment: • An optimal alignment: one with max score Scoring Function • Sequence edits: – Mutations – Insertions – Deletions Scoring Function: Match: +m Mismatch: -s Gap (indel): -d AGGCCTC AGGACTC AGGGCCTC AGG-CTC ~~~AAC~~~ ~~~A-A~~~ • Match = 2, mismatch = -1, gap = -1 • Score = 3 x 2 – 2 x 1 – 1 x 1 = 3 More complex scoring function • Substitution matrix – Similarity score of matching two letters a, b should reflect the probability of a, b derived from same ancestor – It is usually defined by log likelihood ratio (Durbin book) – Active research area. Especially for proteins. – Commonly used: PAM, BLOSUM An example substitution matrix A C G T A C G T 3 -2 -1 -2 3 -2 -1 3 -2 3 How to find an optimal alignment? • A naïve algorithm: for all subseqs A of S, B of T s.t. |A| = |B| do align A[i] with B[i], 1 ≤i ≤|A| align all other chars to spaces compute its value S = abcd A = cd T = wxyz B = xz retain the max -abc-d a-bc-d end w--xyz -w-xyz output the retained alignment Analysis • Assume |S| = |T| = n • Cost of evaluating one alignment: ≥n • How many alignments are there: – pick n chars of S,T together – say k of them are in S – match these k to the k unpicked chars of T • Total time: • E.g., for n = 20, time is > 240 >1012 operations Intro to Dynamic Programming Dynamic programming • What is dynamic programming? – A method for solving problems exhibiting the properties of overlapping subproblems and optimal substructure – Key idea: tabulating sub-problem solutions rather than re-computing them repeatedly • Two simple examples: – Computing Fibonacci numbers – Find the special shortest path in a grid Example 1: Fibonacci numbers • 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, … F(0) = 1; F(1) = 1; F(n) = F(n-1) + f(n-2) • How to compute F(n)? A recursive algorithm function fib(n) if (n == 0 or n == 1) return 1; else return fib(n-1) + fib(n-2); F(9) F(8) F(7) F(6) F(7) F(6) F(6) F(5) F(5) F(5) F(4) F(5) F(4) F(4) F(3) F(9) F(8) F(7) F(7) F(6) F(6) F(5) n F(6) F(5) F(5) F(4) F(5) F(4) F(4) F(3) • Time complexity: – Between 2n/2 and 2n – O(1.62n), i.e. exponential • Why recursive Fib algorithm is inefficient? – Overlapping subproblems n/2 An iterative algorithm function fib(n) F[0] = 1; F[1] = 1; for i = 2 to n F[i] = F[i-1] + F[i-2]; Return F[n]; 1 1 Time complexity: Time: O(n), space: O(n) 2 3 5 8 13 21 34 55 Example 2: shortest path in a grid S m n G Each edge has a length (cost). We need to get to G from S. Can only move right or down. Aim: find a path with the minimum total length Optimal substructures • Naïve algorithm: enumerate all possible paths and compare costs – Exponential number of paths • Key observation: – If a path P(S, G) is the shortest from S to G, any of its sub-path P(S,x), where x is on P(S,G), is the shortest from S to x Proof • Proof by contradiction – If the path between P(S,x) is not the shortest, i.e., P’(S,x) < P(S,x) – Construct a new path P’(S,G) = P’(S,x) + P(x, G) – P’(S,G) < P(S,G) => P(S,G) is not the shortest – Contradiction – Therefore, P(S, x) is the shortest S x G Recursive solution (0,0) • Index each intersection by two indices, (i, j) • Let F(i, j) be the total length of the shortest path from (0, 0) to (i, j). Therefore, F(m, n) is the shortest path we wanted. • To compute F(m, n), we need to compute both F(m-1, n) and F(m, n-1) m n (m, n) F(m-1, n) + length((m-1, n), (m, n)) F(m, n) = min F(m, n-1) + length((m, n-1), (m, n)) Recursive solution F(i-1, j) + length((i-1, j), (i, j)) F(i, j) = min F(i, j-1) + length((i, j-1), (i, j)) (0,0) (i-1, j) (i, j-1) (i, j) m n • But: if we use recursive call, many subpaths will be recomputed for many times • Strategy: pre-compute F values starting from the upper-left corner. Fill in row by row (what other order will also do?) (m, n) Dynamic programming illustration S 0 3 5 3 9 3 5 3 2 6 2 6 13 2 4 17 9 4 5 11 17 11 6 14 2 17 13 13 3 17 2 18 15 3 3 16 4 3 1 3 15 3 7 3 2 2 9 3 6 1 8 13 3 3 2 3 1 3 3 7 12 20 3 2 20 G F(i-1, j) + length(i-1, j, i, j) F(i, j) = min F(i, j-1) + length(i, j-1, i, j) Trackback 0 3 5 3 9 3 5 3 2 6 2 6 13 2 4 17 9 4 5 11 17 11 6 14 2 17 13 13 3 17 2 18 15 3 3 16 4 3 1 3 15 3 7 3 2 2 9 3 6 1 8 13 3 3 2 3 1 3 3 7 12 20 3 2 20 Elements of dynamic programming • Optimal sub-structures – Optimal solutions to the original problem contains optimal solutions to sub-problems • Overlapping sub-problems – Some sub-problems appear in many solutions • Memorization and reuse – Carefully choose the order that sub-problems are solved Dynamic Programming for sequence alignment Suppose we wish to align x1……xM y1……yN Let F(i,j) = optimal score of aligning x1……xi y1……yj Scoring Function: Match: +m Mismatch: -s Gap (indel): -d Optimal substructure 1 2 i M ... x: 1 y: 2 j N ... • If x[i] is aligned to y[j] in the optimal alignment between x[1..M] and y[1..N], then • The alignment between x[1..i] and y[1..j] is also optimal • Easy to prove by contradiction Recursive formula Notice three possible cases: 1. ~~~~~~~ xM ~~~~~~~ yN 2. F(M,N) = F(M-1, N-1) + -s, if not xM aligns to a gap ~~~~~~~ xM ~~~~~~~ 3. m, if xM = yN xM aligns to yN F(M,N) = F(M-1, N) - d yN aligns to a gap ~~~~~~~ ~~~~~~~ yN F(M,N) = F(M, N-1) - d Recursive formula • Generalize: F(i,j) = max F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d (Xi,Yj) = m if Xi = Yj, and –s otherwise • Boundary conditions: – F(0, 0) = 0. -jd: y[1..j] aligned to gaps. – F(0, j) = ? -id: x[1..i] aligned to gaps. – F(i, 0) = ? What order to fill? F(0,0) F(i-1, j-1)1 F(i-1, j) 1 F(i, j-1) 3 2 F(i, j) F(M,N) What order to fill? F(0,0) F(M,N) Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 1 A 2 T 3 A 0 1 2 A G 3 T 4 A Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = 0 0 j=0 1 A -1 2 T -2 3 A -3 1 2 3 4 A G T A -1 -2 -3 -4 Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 A G T A 0 -1 -2 -3 -4 1 0 -1 -2 1 A -1 2 T -2 3 A -3 3 4 Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Optimal Alignment: F(4,3) = 2 Example x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Optimal Alignment: F(4,3) = 2 This only tells us the best score Trace-back x = AGTA y = ATA F(i,j) F(i,j) = max i = j=0 0 F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d 1 2 3 A G T A 0 -1 -2 -3 -4 m= 1 s =1 d =1 4 1 A -1 1 0 -1 -2 A 2 T -2 0 0 1 0 A 3 A -3 -1 -1 0 2 Trace-back x = AGTA y = ATA F(i,j) F(i,j) = max i = j=0 0 F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d 1 2 3 A G T A 0 -1 -2 -3 -4 m= 1 s =1 d =1 4 1 A -1 1 0 -1 -2 T A 2 T -2 0 0 1 0 T A 3 A -3 -1 -1 0 2 Trace-back x = AGTA y = ATA F(i,j) F(i,j) = max i = j=0 0 F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d 1 2 3 A G T A 0 -1 -2 -3 -4 m= 1 s =1 d =1 4 1 A -1 1 0 -1 -2 G T A 2 T -2 0 0 1 0 - 3 A -3 -1 -1 0 2 T A Trace-back x = AGTA y = ATA F(i,j) F(i,j) = max i = j=0 0 F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d 1 2 3 A G T A 0 -1 -2 -3 -4 m= 1 s =1 d =1 4 1 A -1 1 0 -1 -2 A G T A 2 T -2 0 0 1 0 A - 3 A -3 -1 -1 0 2 T A Trace-back x = AGTA y = ATA F(i,j) F(i,j) = max i = j=0 1 A 0 F(i-1, j-1) + (Xi,Yj) F(i-1, j) – d F(i, j-1) – d 1 2 3 A G T A 0 -1 -2 -3 -4 -1 1 0 -1 -2 m= 1 s =1 d =1 4 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Optimal Alignment: F(4,3) = 2 AGTA ATA Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = 0 0 j=0 1 A -1 2 T -2 3 A -3 1 2 3 4 A G T A -1 -2 -3 -4 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 A G T A 0 -1 -2 -3 -4 1 0 -1 -2 1 A -1 2 T -2 3 A -3 3 4 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Using trace-back pointers x = AGTA y = ATA F(i,j) m= 1 s =1 d =1 i = j=0 1 A 0 1 2 3 4 A G T A 0 -1 -2 -3 -4 -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Optimal Alignment: F(4,3) = 2 AGTA ATA The Needleman-Wunsch Algorithm 1. Initialization. a. b. c. 2. F(0, 0) F(0, j) F(i, 0) = 0 =-jd =-id Main Iteration. Filling in scores a. For each i = 1……M For each j = 1……N F(i, j) Ptr(i,j) 3. = max = F(i-1,j) – d F(i, j-1) – d F(i-1, j-1) + σ(xi, yj) UP, LEFT DIAG [case 1] [case 2] [case 3] if [case 1] if [case 2] if [case 3] Termination. F(M, N) is the optimal score, and from Ptr(M, N) can trace back optimal alignment Performance • Time: O(NM) • Space: O(NM) • Later we will cover more efficient methods Equivalent graph problem S1 = A G T A (0,0) S2 = A 1 1 : a gap in the 2nd sequence : a gap in the 1st sequence 1 T 1 A : match / mismatch 1 Value on vertical/horizontal line: -d Value on diagonal: m or -s (3,4) • Number of steps: length of the alignment • Path length: alignment score • Optimal alignment: find the longest path from (0, 0) to (3, 4) • General longest path problem cannot be found with DP. Longest path on this graph can be found by DP since no cycle is possible. Question • If we change the scoring scheme, will the optimal alignment be changed? – Old: Match = 1, mismatch = gap = -1 – New: match = 2, mismatch = gap = 0 – New: Match = 2, mismatch = gap = -2? Question • What kind of alignment is represented by these paths? A A A A A B B B B B C C C C C A- A-- --A -A- -A BC -BC BC- B-C BC Alternating gaps are impossible if –s > -2d A variant of the basic algorithm Scoring scheme: m = s = d: 1 Seq1: CAGCA-CTTGGATTCTCGG || |:||| Seq2: ---CAGCGTGG-------Seq1: CAGCACTTGGATTCTCGG |||| | | || Seq2: CAGC-----G-T----GG Score = -7 Score = -2 The first alignment may be biologically more realistic A variant of the basic algorithm • Maybe it is OK to have an unlimited # of gaps in the beginning and end: ----------CTATCACCTGACCTCCAGGCCGATGCCCCTTCCGGC GCGAGTTCATCTATCAC--GACCGC--GGTCG-------------- • Then, we don’t want to penalize gaps in the ends The Overlap Detection variant yN ……………………………… y1 x1 ……………………………… xM Changes: 1. Initialization For all i, j, F(i, 0) = 0 F(0, j) = 0 2. Termination maxi F(i, N) FOPT = max maxj F(M, j) Different types of overlaps x x y y A non-bio variant • Shell command diff: Compare two text files – Given file1 and file2 – Find the difference between file1 and file2 – Similar to sequence alignment – How to score? • • • • Longest common subsequence (LCS) Match has score 1 No mismatch penalty No gap penalty File1 File2 A B C D E F G B C E F File1 File2 A B C D E F G B C E F LCS = 4 $ diff file1 file2 1c1 <A -->G 4c4 <D -->- The LCS variant Changes: 1. Initialization For all i, j, F(i, 0) = F(0, j) = 0 2. Filling in table F(i-1,j) F(i, j) = max F(i, j-1) F(i-1, j-1) + σ(xi, yj) where σ(xi, yj) = 1 if xi = yj and 0 otherwise. 3. Termination maxi F(i, N) FOPT = max maxj F(M, j) More efficient algorithms • What happens if you have 1 million lines of text in each file? • O(mn) algorithm is too inefficient • Memory inefficient – 1 TB memory to store the matrix • Bounded DP – maybe the majority of the two files are the same? (e.g., two versions of a software) • Linear-space algorithm – same time complexity