Gene analysis of Japanese and American Giant Salamanders Mitochondrial 12S rRNA gene
Download ReportTranscript Gene analysis of Japanese and American Giant Salamanders Mitochondrial 12S rRNA gene
AAST and Kokutaiji collaboration project Gene analysis of Japanese and American Giant Salamanders Mitochondrial 12S rRNA gene The purposes 1. Research collaboration between the Japanese and American high schools 2. Gene analysis of American giant salamander N C V F E P T L (UUR) Andrias japonicus I M W N C Y Q mtDNA S 16,298bp A OL H D R G S (UCN) K L(CUN) (AGY) The method of this research DNA extraction DNA amplification Sequence AAST high school Amplification of mitochondrial genes 12S rRNA and 16S rRNA Win Kokutaiji high school Determination of the nucleotide sequence of the 12S rRNA fragment Comparison with genes of Japanese and Chinese salamanders 12S rRNA gene tree Our next question Nucleotide substitution rate is just 0.1% in the Japanese populations. Evolutionary rate of genes is really slow? or populations experienced a bottle-neck effect? How about in American species? Japanese Giant Salamander DNA music Organism cells are filled with music The all pervasive principle of repetitious recurrence governs not only coding sequence construction but also human endeavor in music composition. Ohno, S and Ohno, M Imunogenetics 24, 1986 Susumu Ohno HoxA13 5’ Homeo box 3’ 77% Salam. Hum. 1:GAACTGGAAAGAGAATATGCGACAAACAAATTCATTACCAAGGACAAACGAAGAAGAATATCCGCAACTACAAGCCTCTCAGAGAGG 87 1:GAACTTGAACGGGAATACGCCACGAATAAATTCATTACTAAGGACAAACGGAGGCGGATATCAGCCACGACGAATCTCTCTGAGCGG 87 ***** *** * ***** ** ** ** *********** *********** ** * ***** ** ** ** * ***** *** ** 96.8% Salam. 1:ELEREYATNKFITKDKRRRISATTSLSER 29 Hum. 1:ELEREYATNKFITKDKRRRISATTNLSER 29 ************************ **** Homeobox gene family HoxA13 forms a finger Hexamers within the salamander Hox region GAACTG GAAAGA GAATAT GACAAA GAAGAA GAATAT GAANDD /C ♯ ♯ Hexamers within the human Hox region salamander GAACTG GAAAGA GAATAT GACAAA GAAGAA GAATAT GAANDD /C human GAACTT GAACGG GAATAC GACAAC GGAGGC GGATAT GRANDB /C