Slide 1

Transcript Slide 1

T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Francis K. Lee, M.Sc, Ph.D.

Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of Pediatrics, Emory University School of Medicine

Newborn Screening Molecular Workshop June 28-30, 2011

National Center for Environmental Health · Division of Laboratory

Overview of SCID – the Condition



Severe Combined Immunodeficiency (SCID) is characterized by the absence of both humoral and cellular immunity

  At least 15 different genes known to cause SCID when mutated All have profound defects in T lymphocyte differentiation and function 

Maternal antibodies wane during first months of life - affected infants develop infections (common / opportunistic pathogens)

  Recurrent infections, chronic diarrhea, sepsis, FTT Death usually before 1 year of age 

Treatment and prevention of infections can prolong life but are not curative



Best hope for SCID patients is Hematopoietic Stem Cell Transplant before the onset of infections SCID has been called “Bubble Boy Disease”

SCID classification

 X linked SCID: Mutation in the γ chain common to IL-2, IL-4, IL 7, IL-9, IL-17 & IL-21 receptors  Autosomal Recessive SCID: Adenosine Deaminase deficiency (20q13.11)

Jak3 tyrosine kinase deficiency (19p13.1)

RAG 1 or 2 defect (11p13) IL-7R deficiency (  chain) (5p13) Purine Nucleoside Phosphorylase deficiency (14q13) MHC II deficiency (16p13, 1q21, 13q) CD3  and CD3  mutations (11q23) CD45 deficiency ZAP-70 deficiency- (2q12 ) Artemis (10p)

Mutations in IL2R gamma chain

NHIGRI, NIH: Genbank accession number L19546

TRECs: Reduced in All Forms of SCID

Common Feature:

ABSENT/NON-FUNCTIONAL T CELLS

IL2R  JAK3 IL7R  CD45 RAG1 RAG2 ARTEMIS ADA Reticular Dysgenesis SCID, multiple bowel atresias SCID, congenital abnormalities Severe DiGeorge Syndrome CD3 Deficiency CD8 Deficiency Severe Ataxia Telangiectasia T T T T T T T T T T T T T+/ T+ T+/ B B B B B+ B+ B+ B+ B+ B+/ B+/ B+/ B+ B+ B+/ NK NK NK+ NK+ NK+ NK+ NK+ NK NK+ NK+ NK+ NK+ NK+ NK+ NK+ Unknown genetic Defect ~5-25%

SCID Meets NBS Criteria

 Prevalence of the disease 1:100,000 or greater

SCID: 1:50,000-1:100,000

 Can the disorder be detected by routine physical exam?

SCID: Baby appears normal at birth.

 Does the disease cause serious medical complications?

SCID: 100% fatal within the first year of life

 Is there a cheap, sensitive and specific screening test?

SCID: Real time PCR to enumerate T cell receptor

excision circles

 Is there a confirmatory test?

SCID: Lymphocyte subpopulation analysis

 Does early detection improve outcome?

SCID: Early HSCT decreases mortality from SCID

Optimal Test to Screen for severe T cell lymphopenia (SCID)

   Must detect low/absent T cells Use existing NBS screening cards Inexpensive, sensitive and specific Low rate of false positive tests Little need for retesting • Real Time PCR (RT-PCR): enumeration of T cell receptor excision circles

(

TREC

- s

urrogate marker for recently produced T cells) using DNA extracted from newborn blood spots collected routinely on all newborns

Overview of TREC Assay for SCID

The T cell Receptor Excision Circle (TREC) assay differs from other molecular assays used in NBS:



Phenotype assay: TREC is a molecular marker for T cell production in thymus



Quantitative assay: require higher level of precision

• •

results influence d by DNA extraction efficiency PCR efficiency

Overview of TREC Assay for SCID (cont.)



T cell receptor excision circles (TREC) are by-products of the rearrangement of T cell receptor (TCR) genes during thymocyte maturation in the thymus



TRECs are episomal DNA and do not replicate during mitosis



Peripheral blood TREC levels reflect T lymphocyte production in the thymus



TREC Assay: Real Time PCR



Variations in TREC Assay procedures can be based on:

 

Primers and Probes DNA extraction procedures

TCR

–Delta deletion in rearrangement of T cell receptor gene

V α 1 V α 2 V α

δRec

V δ1

V δ /

D δ /

J δ C δ ψЈα J α1 J α2 J α3 Jα

C α Chromosomal 14 TCR

α / δ

chain loci Alpha chain V segments ↓ Delta chain V/D/J segments Alpha chain J segments Alpha chain constant region Chromosomal 14 TCR

α / δ

chain loci ↓

Signal joint δRec-ΨJα TREC

Episomal DNA (

δRec-ΨJα TREC)

Chromosomal 14 TCR

chain locus

δRec-ΨJα Coding joint

↓ V α–Јα–Cα rearrangement ↓ TCR alpha chain transcription, translation , expression

5’

Orientation of δRec and ΨЈα sequences in genomic DNA

δRec GTGTCCTCACCCGTGAAA ΨЈα GTCCACGGATACGTAGTGGCAC 3’

Orientation of δRec and ΨЈα sequences in TREC DNA

Signal Joint

5’ -------AAAGGTGCCCACTCCTGTG CACGGTGATGCATAGGCACCTG------ 3’ Forward Primer Direction → ← Reverse Primer Direction

Technical Approaches to TREC Assays

Classical Conventional CDC PE

DBS DNA Extraction DBS DNA Extraction TREC sequence Amplification DBS In Situ Real time PCR DBS In Situ PCR Real time PCR Amplicons Quantification Amplicons Quantification

Dried blood spots (DBS)

TREC Measurement: qPCR

Extract DNA* Enumerate TRECs by real-time qPCR NBS Card 3 mm punch 96 well plate Cord Bloods TREC Amplification Plots

5 4 3 2 1 0 0 10 20

Cycles

30 40 50

In Situ Real Time PCR Assay for TREC

Punch one 2.0 mm discs from DBS specimen into PCR tubes Wash with 125 µl of DNA purification solution S1 (shake for 15 minutes at room temp) Wash with 125 µl of DNA elution solution S2 (shake for 5 minutes at room temp)

In Situ Real Time PCR Assay for TREC (cont.)

Discard S2 wash buffer Add 15 μl of qPCR mastermix (contains complete mix of primers & probe

)

Run qPCR in Stratagene MX3000p: 45 deg for 5 min, 95 deg for 20 min 45 cycles of [ 95 deg x 15 sec + 60 deg x 1 min ] Cord Bloods TREC Amplification Plots

38 37 36 35 34 33 32 31 30 29 28 27 26 0,00

TREC-HeLa DBS calibrators

y = -3.1409x + 36.607

R² = 0.963 E=108% 1,00 2,00

log 10 (cell#/μl blood)

3,00 5 4 3 2 1 0 0 10 20