Transcript (TREC Assay) Future PIDD New Born Screening

Results: NYSDOH New Born
Screening: Severe Combined
Immunodeficiency (TREC Assay)
Future PIDD New Born
Screening: T-,B-cell Defects:
(TREC/KREC Multiplex QPCR)
Vincent Bonagura M.D.
Jack Hausman Professor of Pediatrics
Professor of Molecular Medicine
Hofstra-NS-LIJ School of Medicine
NYS Newborn Screening Program
• Identify presymptomatic newborns
with conditions that can affect longterm health or survival
• All US-born infants are screened by
state of birth
• Each state department of health
(DOH) determines the conditions for
which it screens
• If abnormal, confirmatory testing
needs to be done
• NYS DOH performs >11 million tests
on 250,000 babies born in NYS for
>40 congenital diseases and HIV.
• In 9/2010, NYS became 4th state to
screen for SCID.
Criteria for including a disease in NBS
•
•
•
•
High incidence at least 1:100,000 live births
Disease results in serious morbidity or mortality
Early Dx and Tx significantly improve prognosis
Disorder not readily detected at birth by routine
physical exam
• Sensitive, specific, inexpensive test exists using NBS
cards
• Confirmatory gold standard test for diagnosis exists
Routes et al., (2009). JAMA. 302(22). 2465-70.
Part 1: NYSDOH TREC New Born
Screening Results:
• TREC Assay
– (T-cell rearrangement excision circle
detection)
Immunodeficiency in the context of
B-cell and T-cell development
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
Newborn Screening for TRECs
Baker et al., (2009). Public Health Reports. 125(2).88-95
Excision of TRECs
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
The ultimate goal: high-throughput
screening at NYS DOH
3.2mm punch
1200 DNA extractions/day
Analysis
1500 RT-PCR samples/day
Primer on qRT-PCR analysis
•Fixed threshold (Ct) was set at the point when PCR amplification was in exponential phase
(# cycles at which the amplification passes a fixed threshold).
•The lower the cycle #, the greater # of KRECs present
Baker et al. (2009). JACI.124(3):522-7
Results of NBS For SCID in NYS
• Sept. 30, 2010 -> April 30, 2012,
– 372,660 infants were screened for SCID by
the NYS NBS Program.
– 399 infants were referred for a diagnostic
evaluation
– repeat screening was requested for 469 term
infants.
– repeat specimen was requested for 483
premature infants <37 weeks gestation at time
of specimen collection.
Patients with Abnormal Flow
Cytometry and/or CBC
Incidence of SCID in NYS
• SCID in NYS during the first 19 months of
screening approximately 1 in 53,000.
• The infant diagnosed with JAK3-related SCID
was excluded from the incidence calculation
Previous estimates 1 in 40,000 to 1 in 100,000.
• incidence of SCID in NYS likely higher than
initially suspected.
• Incidence of any T cell lymphopenia was
approximately 1/6,500
Classical SCID
• Seven of eight patients with classic SCID
repeatedly had undetectable TREC copies
• 1 had a single run with above 100 TREC
copies/μl.
– Increased TREC CT to 45 based on this case
Syndromes with T cell impairment
• Most infants identified with a syndrome and T
cell impairment had chromosome disorders with
multi-systemic involvement.
• The most common with T cell impairment
identified by TREC assay was 22q11 deletion
syndrome.
• Approximately 1 in 34,000 newborns were
referred for Immunology evaluation based on
low TREC copy numbers and also had a
chromosome 22q11 deletion.
• TREC assay identified more infants with
DiGeorge syndrome than classic SCID.
Syndromes with T cell impairment
• Incidence of DiGeorge syndrome estimate: 1 in
4,000.
• In NYS, TREC assay identified approximately
12.5% of newborns with DiGeorge syndrome.
• Previous estimates: 80% percent of newborns
with DiGeorge syndrome have some immune
system involvement.
• Severe T-cell depletion (complete DiGeorge)
occurs in <1%
Other Syndromes/Conditions
• 3 newborns with Down syndrome were identified
with low TREC copies/μl
– supports prior finding that reduced TREC copies/μl in
Down syndrome is age dependent
• Largest number of newborns with abnormal flow
cytometry had idiopathic T cell lymphopenia
(ITCL).
• T cell lymphopenia (ITCL) in the context of
newborn screening, not in the literature.
• ITCL = infants without SCID, ? a birth defect or
another syndrome requiring ongoing monitoring
or treatment for T-cell deficiency
Premature Infants
• TREC copy numbers typically normalize
• 1 premature infant with undetectable TREC
copies, multiple congenital anomalies, also had
SCID.
– Algorithm modified: refer all infants with undetectable
TREC copies for diagnostic evaluation regardless of
gestational age because of this case.
– 1st patient in the literature with low TREC copies/ul
prior to 37 weeks gestation
False Positives
• Typically, infants with a normal diagnostic
evaluation had a significant increase in
TREC copy number on repeat specimen to
within the normal range for age.
• Majority of false positive cases likely due
to either poor specimen quality, variation
in the normal range of TREC copies in
newborns or SNPs in TREC DNA
Undetectable TRECs
• One infant referred for diagnostic
evaluation based on undetectable TREC
copies (0,0,0).
• Diagnostic testing including CBC, flow
cytometry, memory cells and mitogens
were normal.
• Failure of the probe to amplify the selected
region was suspected.
• TREC DNA was sequenced and two SNPs
were detected in the FAM probe.
Undetectable TRECs
• The presence of SNPs in the TREC probe
likely explains a normal diagnostic
evaluation in a patient with undetectable
TREC copies on newborn screen.
• Complete failure to amplify may be a rare
occurrence in our population, as it was
verified in 1 out of 372,660 newborns,
however 2 others are yet to be verified.
Population-wide Data
• NYSDOH results supports previous data of
trends in T cell counts in population-wide
studies.
• Lower TREC copies/μl in males in general
population.
• Skewed male:female ratio in referred population.
• Lower TREC copies/μl in individuals from
African American infants.
• It is possible that either common SNPs within
the TREC probe decrease annealing or there is
decreased naïve T cell production. Further
studies needed.
Future Directions
• Continue to evaluate cut-off and algorithm.
• A very conservative cut-off could be used to
detect classic SCID. However, further cut-off
adjustments may reduce number of patients
identified with “non-SCID” disorders.
• Long-term follow-up is necessary to determine
benefits of identifying infants with idiopathic T
cell lymphopenia, or syndromes with T cell
impairment and secondary T cell lymphopenia.
• So far no infants with leaky/variant SCID were
identified
– more data is needed to determine whether further
algorithm adjustments would impact detection of this
group.
Funding Support
• Eunice Kennedy Shriver Institute for Child
Health and Human Development
• The Jeffrey Modell Foundation
• The New York State Department of
Health.
Part 2: Future NYSDOH
TREC/KREC Multiplex QPCR New
Born Screening?
• KREC Assay
– (T-cell rearrangement excision circle
detection)
Why We Should Perform NBS For Xlinked Agammaglobulinemia (Bruton
Disease)
• Estimated incidence 1:200,000
• Mutation or absence of Bruton’s Tyrosine Kinase
(BTK)
• X-linked recessive
– Female carriers have 50% chance of
transmission to son
– Male infant with + family h/o should have
workup
• De novo mutations arise in 30-50% of cases
Genetic etiologies of
agammaglobulinemia
Conley ME.(2009). Curr Opin Immunol.21(5):466-71.
NBS for XLA: a good idea
Screening Criteria
XLA
High incidence
~ 1:200,000
Asymptomatic at birth
Yes
Serious consequences if
untreated
Life-threatening infections
Confirmatory test available
B lymphocyte enumeration, quant
Igs
Effective treatment available
Ig replacement
High volume screening
PCR-based assay, quant Igs at
birth reflect maternal Igs
Cost-effective screening
<<$6.00 for PCR-based TREC
assay (comparable to other
assays) << hospitalizations
Advantages of studying kappa deleting
rearrangements
• Frequently occurs
• One of the last Ig gene rearrangements in bone
marrow-derived B cells before obtaining a functional
Ig molecule
– Abundantly present in naïve B cells which have
undergone successful BCR rearrangement
• Single step rearrangement
– Relatively easy to design primers to detect coding
& signal joints
• End-stage rearrangement
Immunodeficiency in the context of
B-cell and T-cell development
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
Excision of KRECs
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
rtPCR primers to TREC and
KRECs
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
Application of TREC and/or KREC
analysis in newborn screening
van Zelm MC. ,van Der Burg M ,Langerak AW. ,van Dongen J J.M. PID comes full circle:
Applications of V(D)J recombination excision circles in research, diagnostics and newborn
screening of primary immunodeficiency disorders. Frontiers in Immun. (2011) 2:1-9.
Sensitivity levels of cjKRECs and sjKRECs
• Various numbers of purified
normal B cells were serially
added to whole PB from a
patient with XLA (P20) to
obtain B-cell–added XLA
whole blood.
• cjKRECs and sjKRECs
were measured in 3 to 10
samples of each
concentration in triplicate.
• In all analyses, RNaseP
(internal control) was
positive (2.3 ± 0.2 × 105
copies/μg DNA).
• X-axis, B-cell numbers in 1
μL whole blood from a
patient with XLA.
• Y-axis, Percentages of the
KREC-positive results in the
tests.
Nakagawa N, Imai K, Kanegane H, Sato H, et al. Quantification of κ-deleting
recombination excision circles in Guthrie cards for the identification of early B-cell
maturation defects. J Allergy Clin Immunol. 2011 Jul;128(1):223-225.e2.
Detection of KRECs on Guthrie
Cards
• Copy numbers of
sjKRECs measured in
neonatal Guthrie cards or
dried blood spots obtained
from B-cell–deficient
patients.
• On all samples from
control, neonatal Guthrie
cards (n = 133) were
sjKREC-positive (4.8 ± 0.6
× 103 copies/μg DNA).
• B-cell–deficient patients
were negative for
sjKRECs in neonatal
Guthrie cards (XLA, n = 7;
non-XLA, n = 1) and dried
blood spots (XLA, n = 23;
non-XLA, n = 4).
Nakagawa N, Imai K, Kanegane H, Sato H, et al. Quantification of κ-deleting
recombination excision circles in Guthrie cards for the identification of early B-cell
maturation defects. J Allergy Clin Immunol. 2011 Jul;128(1):223-225.e2.
KREC-based screening for B-cell
maturation defects
• These initial results revealed the presence
of >200 KREC copies/μg DNA in healthy
children, whereas no KRECs were
detected in 30 XLA patients and 5 nonBTK agammaglobulinemia patients.
Nakagawa N, Imai K, Kanegane H, Sato H, et al. Quantification of κ-deleting
recombination excision circles in Guthrie cards for the identification of early B-cell
maturation defects. J Allergy Clin Immunol. 2011 Jul;128(1):223-225.e2.
Ongoing Experiments With The
NYSDOH New Born Screening Team
• Determine the feasibility and
optimize conditions for
simultaneous, multiplex detection of
KRECs and TRECs using qRT-PCR
that can be adapted for highthroughput screening by NYS DOH
Primer on QPCR using primers/probes
(1) In intact probes, reporter fluorescence is quenched. (2) Probes and the complementary DNA strand are hybridized and
reporter fluorescence is still quenched. (3) During PCR, the probe is degraded by the Taq polymerase and the fluorescent
reporter released.
•Primer:
DNA sequence that adheres to a strand of DNA used to transcribe the
remaining sequence from the larger strand of DNA for PCR
•DNA-binding dye (SYBR Green) binds to all dsDNA in PCR
•As PCR proceeds   DNA product,  fluorescence intensity
•Fluorescent reporter probe: detect only DNA containing probe sequence significantly
 specificity & allows for quantification despite non-specific DNA amplification
•Quencher: quenches fluorescence
http://en.wikipedia.org/wiki/Real-time_polymerase_chain_reaction
KREC and TREC Real Time PCR
Probe Primer Design
KREC-Forward Primer *
KREC-Reverse Primer *
KREC-PROBE *
TCCCTTAGTGGCATTATTTGTATCACT
AGGAGCCAGCTCTTACCCTAGAGT
NED-TCTGCACGGGCAGCAGGTTGG-MGB
TREC-Forward Primer **
TREC-Reverse Primer **
TREC-PROBE **
TGACACCTCTGGTTTTTGTAAAGG
TGCAGGTGCCTATGCATCA
FAM-CCCACTCCTGTGCACG-MGB
* Sottini A, Ghidini C, Zanotti C, Chiarini M, Caimi L, Lanfranchi A, Moratto D, Porta F, Imberti L.
Simultaneous quantification of recent thymic T-cell and bone marrow B-cell emigrants in patients with primary
immunodeficiency undergone to stem cell transplantation. Clin Immunol. 2010 Aug;136(2):217-27.
** Isabelle J, Caggana M et al. New York State Newborn Screening, Wadsworth Laboratory, Personal
Communication, 2011.
Selection of Multiplex
Fluorochromes
mRNA Probe
TREC
RNAseP
KREC
Ref Dye
TREC and KREC amplification in
a Representative Patient (blue)
and Control (pink)
B)
TREC
BREC
Massaro, Rosenthal, DeVoti, Bonagura, Unpublished, 2011
Summary: Part 2
• Simultaneous newborn screening for Trec and
Krec levels by multiplex qPCR from dried blood
spots (Guthrie cards) is feasible.
• Detecting B-cell PIDD will help identify these
infants before serious/life threatening infections
begin in this infants.
• TREC/KREC simultaneous detection may help
confirm some SCID forms, more precisely target
some SCID defects, and help reduce false
positive results
•
•
•
•
•
Vincent Bonagura, M.D.
James DeVoti PhD
David Rosenthal DO
Luke Massaro
Artemio Jongco MD MPH PhD
NYS Dep. Of Health
• Michele Caggana PhD
• Jason Isabelle PhD
Bonagura Lab Supported by:
NIH R01 DE017227