Transcript DNA
First semester Grade 10 Advanced Unit 4 DNA and protein synthesis Name :------------------------------------------ Class :------------------- Grade 10 Advanced Unit4:DNA&Protein synthesis Booklet key This picture Means that this is a Key words links Exercises Reading text for improving language only Grade 10 Advanced Unit4:DNA&Protein synthesis Contents Topic No. Pg Unit 3 : DNA & Protein synthesis The structure of DNA and RNA………………………………………………. 3 Structure of a nucleotide………………………………………………………. 4 Nitrogenous bases …………………………………………………………… 6 Base pairing……………………………………………………………………. 8 DNA Replication…………………………………………………………………. 11 Meselson and Stahl (1958)……………………………………………………. 12 The genetic code…………………………………………………………….. 15 Transcription……………………………………………………………………. 17 Translation……………………………………………………………………….. 18 Unit project …………………………………………………………………….. 24 Grade 10 Advanced Unit4:DNA&Protein synthesis Unit 4 DNA & Protein synthesis Standards: 10A.11.1 Describe the double-helix structure and semiconservative replication of DNA, and recognise the importance of the base pairings. واالستساخ الذاتي ويدرك أهميةDNA يصف التركيب الحلزوني المزدوج لجزئ ال . تزاوج قواعد هذا الجزئ 10A.11.2Describe the role of DNA, mRNA and tRNA in protein synthesis and understand how a base sequence on DNA controls the structure and function of a protein ويفهم كيف أن، في بناء البروتيناتtRNA ، mRNA ، DNA يصف دور كال من . يتحكم في تركيب ووظيفة البروتينDNA تتابع القواعد في جزئ 10A.11.3 Know that the base sequence on DNA forms the genetic code and is passed from generation to generation وأنه، هو الذي يشكل الشفرة الوراثية أو الجينيةDNA يعرف أن تتابع القواعد في ال . ينتقل من جيل إلى آخر 1 Grade 10 Advanced Unit4:DNA&Protein synthesis Key Words Scientific term معنى المصطلح Scientific term nucleotide non-overlapping adenine protein synthesis thymine transcription cytosine translation guanine amino acid activation complementary base pairing mRNA semiconservative replication tRNA genetic code polyribosome triplet base code codon degenerate anticodon معنى المصطلح 2 Grade 10 Advanced Unit4:DNA&Protein synthesis The structure of DNA and RNA RNA & الDNA تركيب ال Genetic material of living organisms is either DNA or RNA. DNA – Deoxyribonucleic acid RNA – Ribonucleic acid Genes :are lengths of DNA that code for particular proteins. • • • • Both DNA and RNA are polynucleotide's. They are made up of smaller molecules called nucleotides. DNA is made of two polynucleotide strands: RNA is made of a single polynucleotide strand: RNA أوDNA تتكون المادة الوراثية في الكائنات الحية من الحمض النووي الحمض النووي منقوص األكسجين:DNA الحمض النووي كامل األكسجين:RNA . وكل جين يعبرعن بروتين محدد،DNA هي أجزاء من ال: الجينات . من النيوكليوتيدات المتعددةDNA & RNA • يعتبر الحمضين ) • يتكون كالهما من من جزيئات صغيرة تدعى ) نيوكليوتايد . من خيطين من النيوكليوتيدات المتعددةDNA • يتكون ال . من خيط واحد من النيوكليوتيدات المتعددةRNA • يتكون ال Deoxyribonucleic acid nucleotides polynucleotide's. Ribonucleic acid strand Genes 3 Grade 10 Advanced Unit4:DNA&Protein synthesis Structure of a nucleotide تركيب النيوكليوتيدة A nucleotide is made of 3 components: 1- A Pentose sugar This is a 5 carbon sugar The sugar in DNA is deoxyribose. The sugar in RNA is ribose. 2- A Phosphate group Phosphate groups are important because they link the sugar on one nucleotide onto the phosphate of the next nucleotide to make a polynucleotide. 3- A Nitogenous base In DNA the four bases are: Thymine (Uracil in RNA) : أجزاء3 تتكون النيوكليوتيدة من Adenine : سكر خماسي- 1 Cytosine Guanine . ) يسمى السكر ) رايبوز منقوص األكسجينDNA ففي ال، ذرات كربون5 يتكون من . ) فيسمى السكر ) رايبوزRNA أما في ال : مجموعة فوسفات-2 تعتبر مجموعة الفوسفات مهمة ألنها تصل السكر الموجود على النيوكليوتيدة بالفوسفات الموجود على . النيوكليوتيدة التالية لتكوين النيوكليوتيدات المتعددة : قاعدة نيتروجينية-3 :DNA توجد أربعة قواعد في Nitogenous base Adenine Cytosine Pentose sugar Guanine Thymine Uracil )RNA ثايمين ) يوراسيل في أدينين سايتوسين جوانين 4 Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1: Look at the DNA diagram and answer the following questions: : ثم أجب على األسئلة التالية، المرفقDNA انظر إلى نموذج ال: السؤال األول Circle a nucleotide ضع دائرة على نيوكليوتيدة كاملة- Label the sugar and phosphate حدد السكر والفوسفات- Label the bases that are not already labeled حدد القواعد التي لم يتم تحديدها- The two sides of the DNA helix are held together by ___________ bond ____ مع بعض بواسطةDNA يرتبط خيطين ال- The amount of adenine is always equal to the amount of___________ and the amount of guanine is always equal to the amount of _____________ ________ دائما تتساوى أعداد قواعد األدنين مع أعداد قواعد_________ كما تتساوى أعداد قواعد الجوانين مع أعداد قواعد 5 Grade 10 Advanced Unit4:DNA&Protein synthesis Nitrogenous bases القواعد النيتروجينية Pyramidines البريميدينات 1. 2. 3. Thymine - T Cytosine - C Uracil - U Base-Pairing Rule Purines البيورينات 1. 2. Adenine - A Guanine - G : قانون ربط القواعد النيتروجينية A always pairs with T C always pairs with G يرتبط األدينين دائما ً مع الثايمين يرتبط السايتوسين دائما ً مع الجوانين http://student.ccbcmd.edu/biotutorials/dna/dnareppr.html 6 Grade 10 Advanced Unit4:DNA&Protein synthesis )Sugar phosphate bonds (backbone of DNA روابط السكر والفوسفات ) العمود الفقري لجزئ ال )DNA Nucleotides are connected to each other by the phosphate on one nucleotide and the sugar on the next nucleotide to form a Polynucleotide ترتبط النيوكليوتيدات مع بعضها البعض بواسطة ارتباط مجموعة الفوسفات من النيوكليوتيدة السابقة بالسكر الموجود في النيوكليوتيدة الالحقة ،لتكوين النيوكليوتيدات المتعددة . nucleotide bases joined weakly in the middle by hydrogen bonds. ترتبط القواعد الموجودة في النيوكليوتيدات بالوسط مع بعضها البعض بواسطة روابط هيدروجينية ضعيفة . 7 Grade 10 Advanced Unit4:DNA&Protein synthesis Base pairing ر بط القواعد النيتروجينية The Nitrogenous Bases pair up with other bases. For example the bases of one strand of DNA base pair with the bases on the opposite strand of the DNA. ترتبط القواعد النيتروجينية مع بعضها البعض في بحيث ترتبط القواعد الموجودةDNA جزئ ال على أحد الخيطين مع القواعد المتممة لها على الخيط . اآلخر وفق قانون الربط السابق 8 Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1: Fill the space with the correct answer : أملئ الفراغات التالية بالكلمات المناسبة: السؤال األول 1. There are 2 types of nucleic acids: ___________ and ____________ ___________ هناك نوعان من األحماض النووية هما ________________ و-1 2. The 5 nitrogen bases are divided into two groups: Purines which include ___________________ and _______________ Pyrimidines which are ______________, _______________ and ________________ : أنواع من القواعد النيتروجينية والتي تم تصنيفها إلى مجموعتين أساسيتين5 هناك-2 _______________ والتي تشمل _______________ و: البيورينات _______________ والتي تشمل _______________ و: والبيريميدينات Question 2: Choose a color for each part of the nucleotide and fill in the square with the color of your choice. Color the part to match. : لون المربع الموجود أمام كل جزء باللون الذي يعبر عنه في نموذج أسفل: السؤال الثاني Phosphate فوسفات Pentose Sugar سكر خماسي Nitrogen Base قاعدة نيتروجينية 9 Grade 10 Advanced Unit4:DNA&Protein synthesis Question 3 Fill out the following table comparing DNA and RNA : : DNA & RNA إمأل الجدول التالي للمقارنة بين ال: السؤال الثالث DNA RNA Sugar molecule جزئ السكر Bases القواعد Number of strands عدد الخيوط Location الموقع 10 Grade 10 Advanced Unit4:DNA&Protein synthesis DNA Replication DNA نسخ ال It means the copying of DNA. Replication It is described as semi-conservative replication. semi-conservative This means that the DNA molecule replicate and composed produce new molecule with both old and new one. cell division. Each daughter DNA composed of old strand and new strand. DNA replication occurs just before cell division. بمعنى أنه، ويتم فيه اصدار نسخة إضافية مع المحافظة على النسخة األصلية، ونسخهDNA ويعني مضاعفة ال يتكونDNA وكل جزئ جديد من ال، إلنتاج جزئ جديد مع البقاء على الجزئ األصليDNA يتم نسخ جزئ ال وتتم عملية النسخ قبل الدخول، من خيطين ) شريطين ) أحدهما قديم – من األصلي – واألخر جديد يتم تصنيعه . مباشرة في االنقسام الخلوي الجزئ األصلي بعد عملية نسخ واحدةDNA جزيئين 11 Grade 10 Advanced Unit4:DNA&Protein synthesis Meselson and Stahl (1958) 1958 نموذج ميسيلسون & ستال http://users.rcn.com/jkimball.ma.ultranet/ BiologyPages/M/Meselson_Stahl.html 12 Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1: with the reference to the figure below answer the following questions: : أجب على األسئلة التالية، بالرجوع للصورة أسفل: السؤال األول (a) 1. (b) (c) (d) DNA replication occurs just before a cell _________________ ____________ قبل دخولها في DNA تقوم الخلية بنسخ-1 2 . The process of making a copy of DNA is described as __________________ ______________ بالDNA تسمى العملية التي يتم فيها نسخ جزئ-2 3 . Which of the above represents: اختر من األجزاء األربعة السابقة ما يعبر عن-3 - The parental DNA? ____________ األصليDNA جزئ ال - The daughter DNA? _____________ ) المنسوخ ( الجديدDNA جزئ ال 13 Grade 10 Advanced Unit4:DNA&Protein synthesis Question 2: For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after replication. اكتب الشريط أو الخيط المتمم له بعد عملية النسخ، التاليةDNA لكل شريط ) أو خيط ) من أشرطة ال: السؤال الثاني DNA molecule الجزئ األول #1: TACCGGATGCCAGATCAAATC Complementary DNA الجزئ المتمم#1 ________________________________ DNA molecule الجزئ الثاني#2: TACGGGGGCGTAACCACAACT Complementary DNA الجزئ المتمم#2_________________________________ DNA molecule الجزئ الثالث#3: TACCTGTTAAGCTACAAAATT Complementary DNA الجزئ المتمم#3_________________________________ 14 Grade 10 Advanced Unit4:DNA&Protein synthesis The genetic code الشفرة الوراثية It’s the information needed to make particular protein from DNA molecule. Its made up of three bases triplets) . the sequence of bases or triplets is called codon. ATC CTG TAG Each codon matches certain amino acid. Many amino acids make peptide to give protein this is known as protein synthesis genetic code triplets codon protein synthesis peptide هي المعلومات الواجب توفرها لتكوين بروتين محدد من جزئ قواعد نيتروجينية3 وتتكون من، DNA ال . يطلق عليها الشفرة وكل شفرة وراثية تعبر عن حمض ومجموعة األحماض، أميني واحد تتحد مع بعض لتكوين الببتيد ليعطي وهو مايسمى ببناء البروتين. البروتين 15 Grade 10 Advanced Unit4:DNA&Protein synthesis DNA, protein synthesis, mRNA and tRNA ، وmRNA ، بناء البروتين، DNA tRNA Protein Synthesis It is the formation of protein from DNA molecule using the genetic code by transcription and translation. : بناء البروتين باستخدام الشفرة الوراثية بواسطة عمليتي النسخ والترجمة mRNA DNA DNA ويقصد به تكوين البروتين من جزئ . PROTEIN بروتين formation mRNA transcription tRNA translation synthesis.htm_protein_www.biostudio.com/demo_freeman 16 Grade 10 Advanced Unit4:DNA&Protein synthesis 1- Transcription عملية النسخ: ً أوال It is to change DNA in to RNA (messenger RNA) in the nucleus according base pairing (A-U) and (G-C) في النواة وفقا ً لقانون ربط القواعد ) األدنين واليوراسيل ) و DNA ATC CTG TAG GCG mRNA UAG GAC الرسولRNA إلىDNA هي عملية تغيير ال . ) ) الجوانين والسايتوسين AUC CGC Transcription happened because mRNA can leave the nucleus but DNA can’t. . ال يستطيعDNA بينما، الرسول يستطيع مغادرة النواةRNA تحدث عملية النسخ ألن Transcription steps 1. Unwind one gene in the DNA. 2. match up bases of RNA to one side DNA ( A binds T), ( C binds G) 3. mRNA detaches from the DNA. 4. mRNA moves out of the nucleolus into the cytoplasm. • Genetic code= Codon= triple code, they code for specific amino acid. : خطوات عملية النسخ . DNA ينفك أو ينحل جين واحد من جزئ ال-1 . ) والسايتوسين مع الجوانين، ) األدينين مع الثايمينDNA في جانب واحد من الRNA يتم ربط قواعد ال-2 . DNA الرسول من الRNA ينفصل-3 . الرسول النوية ويخرج إلى السيتوبالزمRNA يترك-4 الشفرة الوراثية = الكودون = الشفرة الثالثية . وكل شفرة خاصة بتكوين حمض أميني محدد 17 Grade 10 Advanced Unit4:DNA&Protein synthesis 2- Translation ( process of making a protein) عملية الترجمة: ً ثانيا ) ) عملية صناعة البروتين is the process of using coded mRNA instructions for a sequence of amino acids to produce a polypeptide tRNA is short RNA with one codon matches the mRNA called anti codon and amino acid match the anticodon. Protein synthesis happened in the ribosome. الرسول لتكوين تتابعات من األحماض األمينية تؤدي إلنتاجRNAهي عملية استخدام الشفرات الموجودة في ال . عديد الببتيد الرسول ويسمىRNA فهو يتكون من كودون واحد متصل بال، RNA الناقل أقصرRNA ويعتبر ال . كما تحدث عملية بناء البروتين في الرايبوسوم. ويتصل الحمض األميني بمضاد الكودون، مضاد الكودون mRNA UAG GAC tRNA AUC Peptides (amino acids) Lle AUC CGC CUG UAG GCG Leu Stop Ala different codons mean different amino acids اختالف الكودونات يعني اختالف األحماض األمينية: ) ) األحماض األمينية 18 Grade 10 Advanced Unit4:DNA&Protein synthesis Translation steps 1. mRNA attaches to a ribosome 2. Transfer RNA( tRNA) brings amino acids to build up a copy peptide. 3. Anticodon (3 bases on tRNA) matches up Codon on mRNA . 4. Protein( chain of amino acids) detaches of ribosome and goes of to work. Different Codons means different amino acids. : خطوات الترجمة . الرسول بالرايبوسومRNA يرتبط ال-1 . ) الناقل بإحضار األحماض األمينية لبناء نسخة من الببتيد ) بروتينRNA يقوم ال-2 . الرسولRNA الناقل ) تتصل بالكودون على الRNA قواعد على ال3 ) مضاد الكودون-3 . ينفصل البروتين ) سلسلة من األحماض األمينية ) من الرايبوسوم ويذهب ألداء وظيفته-4 . الكودونات المختلفة تعني أحماض أمينية مختلفة A U G G C C A C U C U G C C C U A A G G G ribosome M et A la Thr Leu Pr 19 Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1 : For each of the same DNA DNA sequences below, write the sequence of messenger RNA codons that is synthesized during transcription. Be sure to separate the codons into triplets. DNA الرسول وفقا ً للتابعات الموجودة على الRNA اكتب الكودونات التي ستتكون على ال: السؤال االول :) قواعد فقط3 والتي ستبني البروتينات أثناء عملية النسخ ) تأكد أن كل كودون عبارة عن DNA molecule #1: TACCGGATGCCAGATCAAATC mRNA #1 _____________________________________________________ DNA molecule #2: TACGGGGGCGTAACCACAACT mRNA #2___________________________________________________ DNA molecule #3: TACCTGTTAAGCTACAAAATT mRNA #3__________________________________________________ 20 Grade 10 Advanced Unit4:DNA&Protein synthesis B) :for each of the mRNA codon sequences you have written, determine the sequence of tRNA anticodons that match it. الناقل تبعا ُ للكودونات الموجودة علىRNA اكتب تتابع القواعد النيتروجينية لمضاد الكودون على ال: ) ب : الرسول التي تم كتابتها في الخطوة السابقةRNA ال Anticodons for mRNA #1: ___________________________________________ Anticodons for mRNA #2: ___________________________________________ Anticodons for mRNA #3: ___________________________________________ Question 2 : Using the chart below, write the amino acid sequence coded for by each mRNA. اكتب األحماض األمينية التي ستنتج عن التسلسل السابق، استخدم الجدول باألسفل: السؤال الثاني Polypeptide #1: __________________________________________________ Polypeptide #2: __________________________________________________ Polypeptide #3: __________________________________________________ 21 Grade 10 Advanced Unit4:DNA&Protein synthesis Question 3: Look at the diagram below and answer the following questions: : ثم أجب على األسئلة التالية، انظر للرسم باألسفل: السؤال الثالث This stage is called ________ تسمى هذه المرحلة ب This stage is called ____________ ______________ تسمى هذه المرحلة ب a) Label the following: protein, mRNA, ribosome, DNA b) DNA transcription takes place in the _________ of the cell whereas the translation occur in the cell _____________ DNA _ رايبوسوم- الرسولRNA - بروتين: أ ) ضع البيانات التالية على الرسمة بينما تحدث عملية، في ______________ الخلية DNA ب ) تحدث عملية نسخ ال . _________________ الترجمة في 22 Grade 10 Advanced Unit4:DNA&Protein synthesis Question4 :For each of the same DNA sequences below, write the sequence of messenger RNA codons that is synthesized during transcription. Be sure to separate the codons into triplets. الرسول والتي سيتم تكوينها أثناءRNA اكتب القواعد النيتروجينية ) الكودونات ) على ال: السؤال الرابع ) ) تأكد من كتابة القواعد على شكل شفرات ثالثية: التاليةDNA لكل سلسلة من سالسل ال، عملية النسخ DNA molecule #1: TACCGGATGCCAGATCAAATC mRNA #1 ____________________________________________ DNA molecule #2: TACGGGGGCGTAACCACAACT : األولDNA جزئ ال الرسولRNA الكودونات على ال للجزئ األول : الثانيDNA جزئ ال mRNA #2________________________________________________ الرسولRNA الكودونات على ال للجزئ الثاني DNA molecule #3: TACCTGTTAAGCTACAAAATT mRNA #3_______________________________________________ : الثالثDNA جزئ ال الرسولRNA الكودونات على ال للجزئ الثالث 23 Grade 10 Advanced Unit4:DNA&Protein synthesis 10 minutes (max) Question5 :Read the text below then answer the following questions. : أقرأ النص التالي ثم أجب على األسئلة التالية: السؤال الخامس Life is specified by genomes , Every organism, including humans, has a genome that contains all of the biological information needed to build and maintain a living example of that organism. The biological information contained in a genome is encoded in its DNA and is divided into discrete units called Genes . 3- Write a summary for the above text. لخص النص السابق بأسلوبك- 3 ……………………………………………………………… ……………………………………………………………… ……………………………………………………………… ……………………………………………………………… 24 Grade 10 Advanced Unit4:DNA&Protein synthesis Your final project is to make a three-dimensional model of DNA. ثالثي األبعادDNA المشروع النهائي عبارة عن تصميم نموذج لل You can work as a group of 3-4 student per group (I want to see a group working not an individual work) Wikipedia, the free encyclopedia is very useful site to start with and get information (nucleotide, DNA, adenine, thymine, cytosine, guanine , complementary base pairing . ) ) يرجى العمل كمجموعة، طالب4 – 3 تستطيعون العمل على شكل مجموعات مكونة من موقع الويكيبيديا يعتبر موقع مفيد ألخذ معلومات متعلقة بالموضوع وتستطيعون االستعانة بهذه . ) قانون ربط القواعد، جوانين، سايتوسين، ثايمين، أدينين، DNA ، المفردات ) نيوكليوتيد Project due date Is آخر موعد لتسليم المشروع -------------- 25 Grade 10 Advanced Unit4:DNA&Protein synthesis Evaluation Rubric For your DNA model DNAمعايير تقييم نموذج ال Category 1- Labels البيـــانات 2- Base Pairing ارتباط القواعد 1 2 3 4 Labels are not accurate or the labels are absent. Some labels are clear and correct Most labels are clear and correct All labels are clear and correct. البيانات غير دقيقة بعض البيانات معظم البيانات جميع البيانات أو غير موجودة موجودة وصحيحة موجودة وصحيحة موجودة وصحيحة Very little of the base pairing is accurate Some of the base pairing is accurate قليل جدا من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق No attention or participation in the discussion. Did not pay attention during model construction. 3- Participation بعض من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق Listened somewhat to the discussion. Had trouble paying attention during model construction. Most of the base pairing is accurate. معظم القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق Participated in or actively listened to the class discussion. Somewhat paid attention during model construction. All base pairs are accurate. جميع القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق Played an active role in the class discussion of the activity. Paid attention during model construction. المشاركة لم يظهروا أي اهتمام أو مشاركة أثناء المناقشة وبناء النموذج االستماع للمناقشة الى واهتمام، حد ما بسيط جدا أثناء بناء . النموذج االستماع للمناقشة و إظهار، بإهتمام بعض االهتمام أثناء . بناء النموذج االستماع للمناقشة بإهتمام وفاعلية و إظهار االهتمام، الشديد أثناء بناء . النموذج 26 Grade 10 Advanced Unit4:DNA&Protein synthesis 27