Transcript * * * Hz
A B * 10 Hz * 5 20 mV 0,25 s 0 C ctrl AA T3 AA+T3 D -100 1,0 -50 mV fractional activation * 0,5 * * * mV -100 -50 0 * 0 pA/pF -5 CTRL AA T3 AA+T3 -10 * Suppl . Figure 1 a Representative action potentials recorded from spontaneously-beating cardiomyocytes obtained from control cells and from cells treated with either AA, T3 or both. b Box plot showing the distribution of firing rates recorded from cells either in control (CTR; 2.3 ± 0.4 Hz n=10) or treated (AA, 2.4 ± 0.3 Hz; n=18; T3, 4.7 ± 0.6 Hz; n=8; AA+T3, 5.8 ± 0.9 Hz; n=9). Black squares indicate the mean values (*p<0, 05 vs control and AA, 1-way Anova and Fisher test for Mean comparison). c Plots of mean activation curves for If current (Vhalf, inverse slope factor (s)) measured in control cells (filled circle; CTR -72.6 ± 2.8 mV, s 8.2±0.7 mV n=11) or in cells treated with AA (empty rhombus; AA -71.3 ±2.1 mV, s 7.7 ± 0.5 mV n=16;), T3 (filled rhombus; -64.8 ± 1.6 mV, s 6.4 ± 0.7 mV n=16) or AA+T3 (black and white rhombus; AA+T3 64.7 ± 2.1 mV, s 6.6 ± 0.6 mV n=15). Lines are the best fitting by the Boltzmann equation. d mean current density-voltage relation under the various conditions (*p<0, 05 vs control and AA, 1-way Anova and Fisher test for Mean comparison). Suppl Figure 1 Suppl. Table 1: Primers sequence for qRT-PCR. Gene HAND1 NKX2.5-promoter HAND1-promoter CASZ1-promoter Forward/reverse (5’ - 3’) CTGAACTCAAAAAGACGGATGGT GCGCCCTTTAATCCTCTTCTC CCCTGCGTTTAGACTCAGCAT TGCTCCTCGTTAGCCTGAAAA GTTGATGAGGCTCTGTCTGTTTTC CCTGTACTGAACCTACCACCCTTT GAGAGGAAGGACCAGGTGTTAGG TAGCAGGGCCTCTTAGCTGTCT Suppl Table 1