Genetic Counseling for Neurogenetic Conditions

Karen Kovak, M.S., C.G.C.

Child Development & Rehabilitation Center Shriner’s Hospital OHSU Cancer Center

Who Should Have a Genetics Consultation?

Individuals and families who are concerned about a genetic disease may benefit from a genetic consultation

whether or not testing is available

for that condition. Many people are seeking information and coping strategies as much as test results.

Genetic Counseling as a Profession

Genetic counseling is the process of helping people understand and adapt to the medical, psychological and familial implications of genetic contributions to disease. This process integrates the following:  Interpretation of family and medical histories to assess the chance of disease occurrence or recurrence.   Education about inheritance, testing, management, prevention, resources and research. Counseling to promote informed choices and adaptation to the risk or condition.

Genetic counseling needs vary depending on the

context

disorder in the family and the options.

complexity

of the of the disorder/testing

Genetics Clinic Evaluation

 Family history  Pregnancy, medical, developmental history  Physical exam  Dysmorphology exam  Diagnostic evaluations  Genetic testing  Genetic counseling  Support and Information Resources

Clinical Features of Huntington Disease



Movement Disorder

 involuntary movements/chorea impaired voluntary movements

Psychiatric Disorder

 major DSM diagnoses nonspecific – irritability, apathy, disinhibition

Cognitive Disorder

organization, sequencing lack of initiation decreased insight/unawareness learning/memory

Age of Onset in Huntington Disease

   Range 2-28 years average around 40 years Juvenile Onset defined as <21 years 5-10% Late Onset defined as >60 years 10% Milder progression/severity?

Progression of Huntington Disease  Early mild motor & mood impairment depression/irritability mild problems with coordination & thinking  Mid speech & swallowing problems chorea – falls, weight loss cognitive impairment leads to inability to work/drive  Late assistance with all ADLs nonverbal/nonambulatory chorea may decline & rigidity appear

Suicide Risk in early/mid stages Survival 3-42 years with average 15-20

Huntington Disease Gene

•CAG trinucleotide repeat expansion •Ranges of repeat size: normal intermediate reduced penetrance affected •Repeat size does not predict age of onset •Repeat size instability

Categories of CAG Repeat Sizes

26 27 35 36 39 40 …CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG… Unaffected “Mutable” Unaffected “Reduced Penetrance” Affected Repeat may be unstable when larger than 26 repeats

Inheritance of Huntington Disease

18 22 42 17 17 22 44 18 42 22

Genetic Testing for Huntington Disease

 Diagnostic/Confirmatory absent family history early/atypical symptoms & family history but no DNA  Predictive/Presymptomatic testing in healthy person without symptoms no medical benefit  Prenatal parental status – gene status known or not prenatal vs. preimplantation

 Genetic testing may be used for

medical management making

and

personal decision-

 Genetic test results usually apply not only to the patient but also to

other family members

 Genetic testing may be performed

in the context of a genetics consultation

and should include informed consent, test interpretation, and follow-up medical and psychosocial services www.geneclinics.org

Genetic Discrimination

 Definition  Analysis of Risk (how big a problem?)  Fear of discrimination in clinical & research practice  Several studies show fear of genetic discrimination is the most common reason for declining genetic services  Legislation

Oregon Genetic Privacy Act

1995: goal of protecting individuals from employment and insurance discrimination on the basis of genetic test results •

HIPAA – Health Insurance Portability & Accountability Act

1996 (took effect 2003): 1)genetic information shall not be deemed a preexisting condition and 2)restricts group health plans from using genetic information to determine insurance eligibility and premiums •

Genetic Information Nondiscrimination Act

of 2005: 1)prohibits discrimination in enrollment & premiums based on request for or receipt of genetic services and 2)prohibits requiring genetic testing

Diagnostic Testing for HD

Prolonged diagnosis Focus on prognosis/management Testing usually done by neurologist How to contact biologic family Onset mild chorea at 45 Normal MRI, thyroid, B12, Vit E Depression/anxiety/memory loss by 50 42 CAGs

Applications for Genetic Testing

?

Diagnostic testing Presymptomatic testing ? Prenatal testing = Huntington disease

Genetic Testing Guidelines

 Genetic Counseling  Results  Support  Psychological Consequences of Testing  Testing Symptomatic Individuals Vs. Non symptomatic  Family Issues/Communication  Reproductive Decisions/Options  Genetic Discrimination

Reproduction Options

 Natural reproduction without genetic testing  Prenatal testing by amniocentesis or chorionic villus sampling –disclosing vs. non-disclosing testing  Egg or sperm donor  Adoption  Surrogate mother  Pre-implantation genetic diagnosis

Most Common Concerns about HD

 When will I get HD?

 Is there a cure for HD?

 How severe will my symptoms be?

 How do I tell my children about their risk and how do I get them tested?

Common risks in Predictive Testing for Huntington Disease

 Negative results are not always a happy ending Not tested BTL at 25 Tested at 44 4

Risks in Predictive Testing – survivor guilt & “unplanned future”

Onset 20s ?

Youngest child was 17 at time of testing No symptoms at age 45 Considering career change 6 months after normal test result, depression requiring hospitalization

Risks in Predictive Testing

 Unanticipated Results Patient did not reveal existence of son until after test results Son was product of brief relationship, and was adopted out through a state agency 35 & 22 CAGs

Risks in Predictive Testing

   Bad outcomes may occur regardless of result Time of risk differs Risk factors for suicide after testing include: unemployment past history of depression contact with persons with Huntington disease no children/no partner   Suicide risk is 4-8 times higher than in non-HD population, and is 2 4 times higher among partners of persons with HD Risks for depression higher with result discrepant from expectation

Risks in Predictive Testing

2 Onset 30s Suicide following uncle’s death

Genetic Test Applications

•Prenatal/preimplantation testing •Diagnostic testing •Presymptomatic testing •Predisposition testing •Carrier testing •Newborn screening

Predisposition Genetic Testing

 Testing of healthy/unaffected persons for a condition with incomplete penetrance  Examples include: BRCA1/2 gene mutations Hemochromatosis  Genetic Counseling needs affected by availability of interventions, certainty of disease

ELSI: Genetic Testing  Should testing be done for susceptibility genes?  role of environmental factors in disease development  Should parents have the right to have their minor children tested for adult-onset diseases?  Are current genetic tests reliable and interpretable by the medical community?

Awareness of Family Health History as a Risk Factor for Disease  Survey of consumers conducted by the CDC  96.3% of respondents considered knowledge of family history important to their personal health  30% reported actively collecting health information from relatives to develop a family health history www.cdc.gov/mmwr/preview MMWR 11/12/04/53(44)

Genetic Tests Differ from Common Laboratory Tests

   Because most genetic disorders are rare, genetic testing is often done only by specialized laboratories. Intense research efforts in molecular genetics result in the rapid development and availability of new genetic tests; therefore, healthcare providers need to continuously update their knowledge. In order for genetic testing to yield meaningful results:    multiple test methodologies may be required other family members may need to be tested a genetics consultation may be appropriate

Charcot- Marie –Tooth Hereditary Neuropathy

  

Disease characteristics:

mode of inheritance Charcot-Marie-Tooth (CMT) hereditary neuropathy refers to a group of disorders characterized by a chronic motor and sensory polyneuropathy. The has distal muscle weakness and atrophy often associated with mild to moderate sensory loss, depressed tendon reflexes, and high arched feet. The CMT hereditary neuropathies are categorized by and causative gene affected individual typically or chromosomal locus . 20 years ago, known by mode of inheritance Currently: autosomal recessive - 7 genes autosomal dominant - type 1 with >4 genes type 2 with>6 genes X-linked - >2 genes www.geneclinics.org

; author Tom Bird, M.D.

Family History of CMT

Possible symptoms No insurance ?

8 yr.

No symptoms 3 yr.

toe-walker Should kids be tested?

Who decides?

What test?

CMT Gene Locations

Duchenne/Becker Muscular Dystrophy

      X-linked Cause may be family mutation, new mutation, or gonadal mosaicism Caused by mutations in dystrophin gene Gene testing can involve multiple steps: 2/3 have large deletion in dystrophin gene 5-10% have point mutation 5-10% may have duplication rest unknown?

DNA testing often obviates need for muscle biopsy New health issues for female carriers

Duchenne/Becker Muscular Dystrophy

Counseling Issues: Who is at risk Prenatal testing available?

6 4 2 1) no deletion 2) sequencing normal 3) duplication testing not available clinically p

What will happen to genetic testing over the next decade?

Dr. Francis Collins www.genome.gov

,

A Brief Primer on Genetic Testing

  Major genetic factors involved in

susceptibility to common diseases

like diabetes, heart disease, Alzheimer’s disease, cancer, and mental illness will be uncovered in the next 5-7 years “It will be important to remember, however, that

most of these tests will not be “yes” or “no” but rather will predict relative risk”