Transcript Keystone review

KEYSTONE REVIEW 1
Biochemistry through DNA/protein synthesis
Biochemistry
• What is an atom?
• An atom is the most basic unit of structure. Each element on the
period table, such as carbon, hydrogen and oxygen, are made up
of atoms.
• Atoms consist of three particles
• Protons: have a positive charge
• Electrons: have a negative charge
• Neutrons: have a neutral charge
• What are compounds?
• Compounds form when atoms join together, like water, which is
hydrogen atoms and oxygen atoms bonded together.
Biochemistry
• What is a bond?
• The sharing or transferring of electrons in the atom’s outer “shell”
• Sharing electrons: covalent bond
• Transferring electrons: ionic bond
• Hydrogen bonds from between hydrogen atoms and other atoms
Biochemistry
• What’s so special about carbon?
• Carbon has 4 electrons in it’s outer shell so it can form 4 bonds
• Carbon is found in all of the macromolecules such as
• Proteins
• Lipids (fats)
• Carbohydrates
• Nucleic acids (DNA material)
Biochemistry
• What’s so special about water?
• Water (hydrogen atoms + oxygen atoms) is a polar molecule
• Polarity refers to the distribution of electrons between two atoms (that
are sharing their electrons)
• Water is considered polar because the hydrogen atom’s electrons are
shared UNEQUALLY with the oxygen atom’s electrons
•
Polar
Nonpolar
Biochemistry
• What’s so special about water?
• It’s attracted to some substances and it repels others
• Hydrophobic: water-hating. These substances don’t mix with water
• Ex: Oil
• Hydrophilic: water-loving. These substances DO mix and dissolve
in water
• Ex: Sugar
Biochemistry
• What’s so special about water?
• Water is a natural buffer, meaning it stabilizes the pH of substances
• Acid: any substance that releases hydrogen ions (H+) when
dissolved in water
• Ex: lemon juice, hydrochloric acid
• Base: any substance that releases hydroxide ions (OH-) when
dissolved in water
• Ex: ammonia, bleach
Biochemistry
• What’s so special about water?
• Water molecules have sticky properties
• Adhesion: when water sticks to other surfaces
• Think: water sticking to your car windshield
• Cohesion: when water molecules stick to one another
• Think; water forming droplets
• Surface tension: when water forms a surface that resists external
forces
• Think: belly flopping off the diving board
• Capillary action: when water flows against gravity up a plant stem
• Think: paper towel soaking up water
Biochemistry
• Macromolecules
• Proteins
• Lipids
• Carbohydrates
• Nucleic acids
• Made up of monomers (building blocks)
• Macromolecules build together to make cell structures,
which build together to make us!
Biochemistry
• Proteins
• Monomer: amino acid
• Elements that make up proteins: carbon (C), nitrogen (N), oxygen
(O), hydrogen (H) and sometimes sulfur (S)
• Function/propose: make up muscles, act as markers on cells
(identify the cell as a special type), act as enzymes that speed up
reactions, fight disease and transport materials into and out of cells
• Reaction: amino acids are joined together through a reaction called
dehydration synthesis. Two amino acids are joined together by a
bond called a peptide bond
Biochemistry
• Amino acids are made up of a central carbon that is attached to a
carboxyl group (COOH), a hydrogen, an amino group (NH2) and a “R”
group
• R groups differ from one amino acid to another, making each amino
acid unique
• There are 20 amino acids in existence
Alanine
Serine
Biochemistry
• When amino acids join together (through a reaction called
dehydration synthesis, and by a bond called a peptide
bond), they from a polypeptide
• A polypeptide is a chain of amino acids
• Polypeptides=proteins
Biochemistry
• Enzymes are types of proteins. Their job is to speed up
reactions and act as catalysts.
• Enzymes fit, like a lock and key, with a substrate. The
place where they join is called the activation site.
• A substrate is what the enzymes acts on.
• EX: lactose intolerance
• Lactose is a sugar found in dairy products. Normally, there is an
enzyme that occurs naturally in a person’s body. When they
consume dairy products, and their body is filled with the lactose
sugar, the enzyme lactase acts on the lactose sugar and breaks it
down so it can be digested. People with lactose intolerance are
lacking the enzyme (or it doesn’t function properly) lactase, so
when they eat dairy products and take in the lactose sugar, they
are unable to digest it and they have stomach “issues” as a result.
Biochemistry
• This is not the only function of enzymes.
• Enzymes also speed up reactions so that your body
doesn’t have to use all of it’s energy (that it gets from
breaking down food) on simple tasks like breathing.
• Enzymes are never used up, but can be affected by things
like pH, temperature and salt concentration. These things
can alter an enzyme’s shape, making it impossible for the
substrate and the enzyme to fit properly.
Biochemistry
• Lipids are fats, oils, steroids, and waxes
• Monomer: Fatty acid
• Elements: Carbon (C), hydrogen (H), Oxygen (O). They have HIGH
amount of hydrogen atoms (for every 1 carbon there are 2
hydrogens)
• Function/purpose: Fats provide cells with protection and insulation,
steroids are our hormones, waxes provide waterproof coverings
(ear wax or waxy plant leaves like ivy). Lipids make up the cell
membrane (lipid bilayer!)
Biochemistry
• Different types of lipids
• Saturated: fats that have single (covalent) bonds between the
carbon atoms
• Unsaturated: fats that have some double (covalent) bonds between
the carbon atoms. The electrons are shared twice, in a sense.
• Polyunsaturated: fat that have many double (covalent) bonds
between the carbon atoms.
Biochemistry
• Carbohydrates
• Monomer: monosaccharide
• Elements: Carbon (C), Hydrogen (H) and Oxygen (O)
• Function/propose: main source of energy for the body
• Reaction: Dehydration synthesis joins two monosaccharides
together.
Biochemistry
• Disaccharides: two monosaccharides joined together
• Polysaccharides: many monosaccharides joined together
Biochemistry
• Nucleic acids
• Monomer: nucleotide
• Elements: Carbon (C), Oxygen (O), Nitrogen (N), Phosphorus (P),
and Hydrogen (H)
• Base: Adenine, thymine, cytosine, and guanine
• Sugar: a monosaccharide
• Phosphate bonded to 3 hydrogens
• Function/purpose: DNA (the heredity molecule that stores genetic
information, RNA (like DNA’s simpler form), ATP and NAD (energy
storing molecules involved in photosynthesis and cellular
respiration reactions)
Biochemistry
• Two types of bases: pyrimidine and purines.
• Adenine (A) and guanine (G) are purines
• Thymine (T) and cytosine (C) are pyrimidine
Cells
• The cell membrane
• Function: to control what enters and exits the cell
• Composition: a phospholipid bilayer (two layers of fats)
• Arranged tail to tail
Cells
• Also embedded in the cell membrane are
• Proteins: help large molecules move into and out of the cell
• Peripheral protein: on the surface of the cell (mostly involved in cell
identification and recognition)
• Integral protein: go the entire way through the membrane (helps
molecules get into and out of the membrane, like a tunnel!)
• Cholesterol: makes the membrane more rigid
Cells
• Transport into and out of the cell
• Passive transport: doesn’t require energy
• Molecules move by diffusion: the movement of molecules from a high
concentration to a low concentration
• THINK: does it take energy to ride a bike from high on a mountain to low
on a mountain?
• Solute: the solid substance
being dissolved (sugar, salt etc.)
• Solvent: the liquid substance
doing the dissolving (usually water)
Cells
• Diffusion occurs when a “system” is not a equilibrium
• Equilibrium is when all things are equal
• Solutes move from high  low until there is an equal
amount on each side (of the cell, inside/out)
• Things that affect diffusion
• Temperature: a system at a higher temperature will cause diffusion
to occur more quickly. THINK: does hot chocolate powder dissolve
faster in hot water or cold water?
• Size: larger solute molecules diffuse slower into/out of a system or
a cell. THINK: human running through a jell-o wall vs. an ant
Cells
• Osmosis is the diffusion of specifically WATER into or out
of a cell
• Cells need water to live but too much water can be fatal
• Types of tonicity
• Hypertonic solutions: cause the cell to shrink because water is
leaving the cell.
• Why is water leaving? The concentration of water inside the cell is
greater than the concentration of water outside of the cell, so the water
moves from high to low OUT OF THE CELL
• Hypotonic solutions: cause the cell to swell because water is
entering the cell.
• Why is water entering? The concentration of water inside the cell is
lesser than the concentration of water outside the cell, so the water
moves from high to low INTO THE CELL
Cells
• Isotonic solution: water moves into and out of the cell at an equal
rate
Cytosol is the
gel-like fluid
inside a cell
(in this case,
a red blood
cell)
Cells
• Facilitated diffusion: molecules that need help crossing
the membrane use proteins as tunnels. They still move
from a high concentration to a low concentration.
Glucose
High
concentration
Phospholipid
bilayer
Integral
protein
Low
concentration
Low
Concentration
Cell
Membrane
High
Concentration
Glucose
molecules
Protein
channel
Cells
• Active transport: requires energy to move molecules from
a low concentration to a high concentration
• THINK: does it require energy to move a bike from low on a
mountain to high on a mountain?
• Pumps are required to move the molecules
Cells
• Endocytosis - cell membrane
engulfs and takes in materials
• Phagocytosis - solid material
taken in
• Pinocytosis - liquid material
take in
Cells
• Vesicles, sacs that are carrying either solid or liquid
materials, fuse with the cell membrane and release their
contents or take in contents
Cells
• Types of cells
• Prokaryotic cells: cells that lack a nucleus and other internal
organelles.
• Ex: bacteria
• Eukaryotic cells: cells that contain a nucleus and other internal
organelles
• Ex: plant cells and animal cells
• Organelles: “tiny organs” inside the cell that help the cell
carry out various processes and functions to keep it alive
Organelles
• Cell membrane
• Found in both plant and animal cells (and prokaryotic cells like
bacteria)
• Surrounds the cell and provides protection
• Controls what enters and exits the cell
Organelles
• Cell wall
• Found surrounding plant cells (eukaryotic) and bacteria cells
(prokaryotic)
• Provides extra support and structure for the cell
Organelles
• Nucleus
• Found in both plant and
animal cells
• Brain of the cell. Controls all
cell functions. Where DNA is
located
• Has a membrane around it,
called the nuclear membrane
• Material (such as RNA) can
enter and leave the nucleus
• Has an inner core known as
the nucleolus where
ribosomes are made
Organelles
• Mitochondria
• Found in both plant and animal cells
• Known as the powerhouse of the cell because it makes energy for
the cell. Involved in cellular respiration.
• Has two membranes surrounding it
• Has folds inside,
which are called cristae
Organelles
• Vesicles
• Found in both plant and animal cells
• Small sacs or pouches that transport materials around the cell
• Involved in exocytosis and endocytosis
• Types
• Peroxisomes: found in both plant and animal cells. They break down
fatty acid chains
• Lysosomes: found in only animal cells. Contain digestive enzymes that
help clean up the cell
Organelles
• Ribosomes
• Found in both plant and animal cells
• Made by the nucleolus
• Attach themselves to the rough endoplasmic reticulum
• Responsible for attaching to RNA and aiding in translation, which is
the process of making proteins
Organelles
• Rough endoplasmic reticulum
• Called rough ER for short
• Found in both plant and animal cells
• Responsible for transporting proteins.
• Smooth endoplasmic reticulum
• Called the smooth ER for short
• Found in both plant and animal cells
• Responsible for breaking down fats and toxic substances
Organelles
Organelles
• Golgi body (apparatus)
• Found in both plant and animal cells
• Responsible for modifying proteins that are made by the rough ER
and ribosomes and then packaging them for distribution by vesicles
Organelles
• Chloroplasts
• Found only in plant cells
• Responsible for preforming photosynthesis
• Green in color because they contain the pigment chlorophyll
Organelles
• Vacuole
• Found in both plant and animal cells
• Responsible for storing water and other important materials
• Can expand or shrink depending on the needs of the cell
PHOTOSYNTHESIS
Reactants
Sunlight + 6CO2 + 6H2O
C6H12O6 + 6O2
Products
Photosynthesis
• The process of taking light energy and converting it into
chemical energy ( sugars)
• 3 stages of photosynthesis
• Energy capture from sunlight
• Light energy is converted into chemical
energy and stored in a molecule of ATP or
NADPH
• Chemical energy stored in ATP or NADPH is
used to make organic compounds ( sugars)
ATP
A nucleotide with two extra energy-storing phosphate
groups
H20 + ATP  ADP + P + energy
Water + ATP  adenosine diphosphate + phosphate + energy
Cell use the energy released by this reaction to power
metabolism.
Plant parts
• Stomata: openings in plant leaves and stems where gas
exchange occurs
• Mesophyll: plant tissues
• Chloroplasts: organelle that does photosynthesis
Stroma: gel-like fluid inside chloroplasts
Granum: stacks of thylakoids
Thylakoid: site of photosynthesis
Lumen: empty space inside thylakoid
What is chlorophyll?
• A pigment that absorbs red and blue light, and reflects
green light
• This is why plants appear green
• Chlorophyll is responsible for capturing the energy from
the sun
Photo 1- light dependent
reactions
• Stage 1
• Energy capture from sunlight
• Pigments are in disc-shaped structures called thylakoids
• When light strikes a thylakoid, energy is transferred to electrons in
chlorophyll
• This causes the electrons to have extra energy, they are said to be
“excited”
Photo 1- light dependent
reactions
• Excited electrons jump to other molecules in the
thylakoid membrane
• The electrons that left must be replaced
• They are replaced by e- from water splitting apart
• The oxygen left over is released into the atmosphere
as gas (we breathe it!)
1. Light strikes
thylakoid=excites
electrons
EEE-
O2 gas
H+
electrons
H2O
Thylakoid
2. H20 splits a part. H+ is used
to replace the electrons. O2 is
released into the atmosphere
• Stage 2
• Electron transport chains move the excited electrons along the
thylakoid membrane
Photo 2- light dependent
reactions
• Electron transport chains
• Excited electrons pass through pumps in the thylakoid
membrane. They lose some of their energy
• That energy is used to pump hydrogen (H+) ions into the
thylakoid
• This creates a higher concentration of H+ inside than
outside, so they DIFFUSE back out of the thylakoid
2. The energy is
used to pump H+
ions into the
thylakoid
1. Electrons
leave the
thylakoid. This
creates energy
EEE-
H+H+
H+H+
Thylakoid
3. H+ ions diffuse
out. This triggers
the ATP reaction
Photo 2- light dependent
reactions
• The H+ ions pass through carrier proteins in the membrane.
(facilitated diffusion)
• The carrier proteins create a reaction in which a phosphate group is
added to the chemical ADP, making ATP!
• This ATP is used to power the third stage of photosynthesis
Thylakoid
ADP + P  ATP
Photo 2- light dependent
reactions
• There is a second electron transport chain that provides energy to
make another chemical called NADPH
• NADPH is an electron carrier that provides the high energy
electrons needed to make carbon-hydrogen bonds in the third
stage of photosynthesis
Overview of light dependent
reactions
• Pigment molecules in the thylakoids of chloroplasts
•
•
•
•
absorb light energy
Electrons in the pigments are excited by light and
move through electron transport chains in the
thylakoid membranes
These electrons are replaced by electrons from
water molecules which are split
Oxygen atoms and from water splitting combine to
form oxygen gas
Hydrogen ions accumulate inside thylakoids and
then diffuse out which provides the energy to make
ATP
Stage 3-light independent
reactions
• Does not require light
• Carbon atoms from carbon dioxide (in the atmosphere)
are used to make organic compounds  sugars!
• Carbon dioxide fixation: transfer of carbon dioxide to
organic compounds
Photo 2- Light independent
reactions
Stage 3
The Calvin cycle (4 steps)
1. in carbon dioxide fixation, each molecule of carbon dioxide (CO2) is added to a
five-carbon compound by an enzyme.
2. The resulting six-carbon compound splits into 2 3-carbon compounds. Phosphate
groups from ATP and electrons from NADPH are added to these compounds,
forming three-carbon sugars
3. One of the resulting three-carbon sugars is used to make organic compounds
(starch and sucrose) which is stored by the organism
4. The other three-carbon sugars are used to regenerate the initial five-carbon
compound, completing the cycle
1.C-C-C-C-C
2.CO2 + C-C-C-C-C
3. C-C-C
Stored as sugar for
plant to use as food
C-C-C
Starts the carbon
dioxide fixation process
over again
Factors that affect photosynthesis
• The rate of photosynthesis increases as the intensity of
light increases, until all the pigments are being used.
• At this “saturation point”, the Calvin cycle cannot move
any faster
• Same thing happens after the saturation point of carbon
dioxide is reached
OVERVIEW
• Changing light energy into
chemical energy
• Requires CO2 and H2O
• Oxygen and glucose are the
products
CELLULAR
RESPIRATION
Transferring energy from organic compounds
(sugars) to ATP
Stages of Cellular Resp.
• Stage 1: Called Glycolysis. Glucose is broken down into a
compound called pyruvate, producing a small amount of
ATP and NADH
• Stage 2: Has different names depending on if oxygen is
present and used in the process
• Krebs Cycle: aerobic, oxygen is present
• Fermentation: anaerobic, oxygen is absent
Stage 1: glycolysis
• Glucose is broken down in the CYTOPLASM (gel-like fluid
that surrounds all the organelles inside the cell)
• Does not require oxygen, anaerobic
• NADH plays the same role in cellular respiration that it did
in photosynthesis
• It’s an electron carrier
Steps of glycolysis
• 1) phosphate groups from 2 ATP molecules are
transferred to a glucose molecule
• 2) the resulting 6-carbon compound is broken down into
2, 3-carbon compounds, each with a phosphate group
• 3) two NADH molecules are produced
• 4) each 3-carbon compound is converted to a 3-carbon
pyruvate, producing 4 ATP molecules
Stage 1: glycolysis
• Glycolysis uses 2 ATP, but generates 4
• Glycolysis is followed by another set of reactions that use
the energy temporarily stored in NADH to make more ATP
Glycolysis reactants & products
Stage 2: Aerobic
• Aerobic means that oxygen is required to run the process
• We call aerobic respiration of stage 2, the Kreb’s Cycle
Kreb’s Cycle
• 1) Acetyl-CoA combines with a 4-carbon compound,
forming a 6-carbon compound and releasing coenzyme A
Kreb’s Cycle
• 2) carbon dioxide, CO2, is released from the 6-carbon
compound, forming a 5-carbon compound. Electrons are
transferred to NAD+, making a molecule of NADH
• 3) carbon dioxide is released from the 5-carbon
compound, resulting in a 4-carbon compound. A molecule
of ATP is made, and a molecule of NADH is also
produced
Kreb’s Cycle
• 4) the existing 4-carbon compound is converted to a new
4-carbon compound. Electrons are transferred to an
electron acceptor called FAD, making a molecule of
FADH2 (electron carrier)
• 5) The new 4-carbon compound is then converted to the
4-carbon compound that began the cycle. Another
molecule of NADH is produced
Chemicals and their jobs
• Electron Acceptors: NAD+ and FAD
• Electron Carriers: NADH and FADH2
• Chemical form of energy: ATP
• Equations
• NAD+ + electron  NADH
• FAD + electron  FADH2
• ADP + P  ATP
Electron Transport Chains
• 1) Hydrogen ions (H+) are pumped out of the inner part of
the mitochondria
• 2) Electrons and hydrogen ions combine with oxygen,
forming water
• 3) ATP is produced as hydrogen ions diffuse into the inner
part of the mitochondria through a channel protein
(facilitated diffusion)
Stage 2: anaerboic
• Anaerobic means that oxygen is not required to run the
process
• Anaerobic respiration occurs when there is not enough
oxygen to run the Kreb’s Cycle
• This process is called Fermentation. There are two types
• Lactic Acid Fermentation
• Alcoholic Fermentation
• In this process, NAD+ is recycled and allows glycolysis to
continue. A small amount of ATP is produced
Lactic Acid Fermentation
• A 3-carbon pyruvate is converted
to a 3-carbon lactate through
lactic acid fermentation
• Lactate is the ion of an organic
acid called lactic acid
• Fermentation enables glycolysis
to continue producing ATP as long
as the glucose supply lasts.
• Lactic acid builds up in your muscles
and is removed by your blood.
Lactate can build up in your muscle
cells if it is not removed quickly
enough, sometimes causing sore
muscles!
• Bacteria and other animals that
are anaerobic use LAF
Alcoholic Fermentation
• The 3-carbon compound
pyruvate is broken down to
ethanol, a 2-carbon
compound.
• Carbon dioxide is released
during the process
• Alcoholic fermentation by
yeast, a fungus, has been
used in the preparation of
many foods and beverages
• Wine and beer making
• Carbon dioxide released by yeast
causes dough to rise Carbon
dioxide released by yeast causes
carbonation in beer
ATP Production
• Glycolysis: 2 ATP molecules gained
• Aerobic respiration: 2 ATP molecules gained
• Electron transport chain: 34 ATP molecules gained
•TOTAL= 38
• Fermentation produces a small amount of ATP
DNA
• Name: Deoxyribonucleic Acid
• Structure:
• Double helix “twisted ladder”
• Phosphate and sugar “backbone”
• Nitrogen bases that form complimentary pairs
• Adenosine (A) Thymine (T)
• Guanine (G)  Cytosine (C)
• Hydrogen bonds join the bases together
• A and G are purines
• T and C are pyrimidines
DNA
DNA
• Function:
• Carries a genetic code (order of the bases like agctatgca…)
• This genetic code is the recipe for how to make specific proteins
• Those proteins assemble into parts of the cell and body to make up
unique traits such as hair color, eye color and skin color
DNA
• Genes
• Genetic code: the order of the bases.
• Different order=different people and even different species!
• Gene: a segment of DNA that codes for a protein
• Chromosome: a long chain of DNA all coiled up
• Humans have 46 chromosomes, each with 1,000’s of genes on them
• Other species have different amount of chromosomes
DNA
• Making more DNA= DNA replication
• DNA needs to make copies of itself so that every new cell
that is made, has a copy of DNA
• You make new cells all the time (new skin cells daily!)
• How does DNA replicate?
• 1. An enzyme, called DNA helicase, binds to DNA and unzips it
• 2. DNA helicase unzips the DNA molecule by breaking hydrogen
bonds between the bases
• 3. Another enzyme, DNA polymerase, binds to DNA and adds NEW
bases to each side of the DNA “ladder”
ATGGCTAATCCGT
TACCGATTAGGCA
TAGGCCT
DNA
helicase
ATCCGGA
ATGGCTAATCCGTTAGGCCT
TACCGATTAGGCAATCCGGA
TACCGATTAGGCAATCCGGA
DNA polymerase
ATGGCTAATCCGTTAGGCCT
DNA
• Sometimes, DNA polymerase makes mistakes
• A  G by accident!
• Proof-reader enzymes are responsible for checking the newly
added strand for such mistakes
DNA
• One of DNA’s roles is the recipe for making protein
• How does DNA make proteins?
• First off, DNA cannot leave the nucleus. Proteins can only be made
in the cell’s cytoplasm and if DNA enters the cytoplasm, it will start
to break down.
• So, to solve this problem, the cell uses another molecule that is
similar to DNA. This molecule carries DNA’s recipe or message into
the cytoplasm so that proteins can be made
• The molecule is called RNA
RNA
• Name: Ribonucleic Acid
• Structure:
• A single helix (one sided “ladder”)
• A phosphate and sugar “backbone”
• Nitrogen bases that form complimentary pairs
• Adenosine  Uracil (NOT THYMINE)
• Guanine  Cytosine
Transcription
• Transcription occurs when RNA makes a copy of DNA
• Why does this happen? Because DNA cannot leave the nucleus,
and protein are made OUTSIDE of the nucleus, in the cell’s
cytoplasm
• Steps
• 1. DNA is unzipped by the enzyme DNA helicase
• 2. The enzyme RNA polymerase, begins to add complimentary
RNA bases to ONE STRAND of DNA
• 3. The newly made RNA strand detaches, and leave the nucleus
• This strand of RNA is specifically called messenger RNA, or mRNA
Transcription
Translation/protein synthesis
• What happens to RNA after it leaves the nucleus?
• It travels into the cell’s cytoplasm and the process of translation
begins.
• Translation is also called protein synthesis (the making of proteins)
• What are the steps of translation?
• 1. mRNA hooks up to a ribosome
• 2. A different type of RNA, transfer RNA (tRNA) brings
complimentary bases and attaches to the mRNA
• 3. tRNA is also carrying amino acids. Amino acids are the building
blocks for proteins
• 4. When the bases of mRNA and tRNA are joined, the amino acid
carried by tRNA pops off
• 5. Amino acids start to form chains, called polypeptides (a.k.a
proteins)
Translation/protein synthesis
• When tRNA attaches to mRNA, it does so through
anticodons
• mRNA has codons, which are a group of 3 bases
• AUG
• tRNA has anticodons, which are a group of 3 bases that are
complimentary to the codons on mRNA
• UAC
• A codon is what “codes” for one amino acid
• mRNA codons
• Amino acids
Translation/protein synthesis
• Amino acids
• There are 20 amino acids
• Some codons “code” for the same amino acid
• Some codons “code” for the cell to stop or start producing amino
acids
tRNA
Nucleus
Amino
acid
mRNA
Anticodon
Cytoplasm
Ribosome
Chain of amino
acids=
polypeptide
Mutations
• There can be mistakes that occur along the way
• During DNA replication
• During Transcription
• During Translation
• Types of mutations
• Point mutations-one base of DNA/RNA is altered
• Substitution, insertion, deletion
• Can cause a frame-shift mutation
• Chromosome mutation-a segment or whole chromosome is altered
Mutations
• Substitution: when one base is substituted for another
• Deletion: when one, or more, base is deleted
• Insertion: when one, or more, base is added
• Both insertions and deletions can cause frame-shift mutations
• Frame-shift mutations cause codons to be read differently. These
changes can cause different amino acids to be coded for, which will
lead to incorrect protein assembly
Mutations
• Chromosome mutations
• Deletion- part of a chromosome
is deleted
• Duplication- part of a
chromosome is doubled
• Inversion- part of a
chromosome flips around and
reattaches
• Translocation- non-
homologous pairs exchange
chromosome segments