Transcript Prentice Hall Biology - Mid
Go to Section:
Section 13-1 Interest Grabber A New Breed
The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits?
Go to Section:
Section 13-1 Interest Grabber continued
1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed. 2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.
3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.
Go to Section:
Go to Section:
Characteristic
Dog 1
Dog 2
Cross Breed (Hybrid)
Size Color
Type of Coat
Go to Section:
Go to Section:
Mutations
Normal Green-cheek Pair
Go to Section:
Cinnamon Green-cheek pair, Yellow-sided Green-cheek
Concept Map Section 13-1 Selective Breeding
consists of Inbreeding which crosses Similar organisms for example for example Hybridization which crosses Dissimilar organisms Organism breed A which Retains desired characteristics Organism breed A which Organism Combines desired characteristics breed B Go to Section:
Hybridization of two different plants leads to a hybrid with a combination of both parents traits Go to Section:
Hybrids only possible between closely related species Offspring are usually sterile Go to Section:
Mutations
Increases variation which is the raw material for selective breeding and evolution Sometimes mutation can be introduced by mutagens like X-rays and chemicals.
Go to Section:
Seedless Watermelons are triploid (3N) It is POLYPLOID
Go to Section:
Section 13-2 Interest Grabber The Smallest Scissors in the World
Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?
Go to Section:
Section 13-2 Interest Grabber continued
1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.
3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Go to Section:
Go to Section:
Go to Section: Restriction enzymes can only fit the DNA at a specific base sequence EX: CTTAAG Animation Animation
Go to Section:
Go to Section:
Go to Section:
Plasmid Go to Section:
Ligase seals backbone
Go to Section:
Genetic Marker Go to Section:
Only some bacteria get a plamid TRANSFORMED Antibiotic added to screen out those without plasmid Only one plasmid has the FROG gene Frog rRNA labelled with radioactive tracer is used to find which plasmid has the frog gene Bacteria with frog gene can now be cloned
Animation Go to Section:
The plasmids are reinserted into the bacteria, but only some take up the plasmid -they must be SCREENED OUT
DNA probe (with radioactive tag) complementary to frog gene
Cloning Animation Animation of removing introns to put eu gene in prokaryote Go to Section:
Four Stages in Genetic Engineering
1. Cleaving DNA 2. Producing Recombinant DNA 3. Transforming (and then Cloning Cells) 4. Screening Target Cells with gene 5. (Clone the screened Target cell)
Go to Section:
Go to Section: 2. Why does cell division produce bacterial cells that all contain the protein-
V
gene?
When the bacterial cell undergoes cell division, the recombinant plasmid is replicated.
P 365
Go to Section:
Plasmid used as a vector Go to Section:
Phage used as a vector Go to Section:
Go to Section:
Ti plasmids in bacteria can cause tumors in plants If the tumor causing gene is removed from the plasmid and a useful gene spliced in - the Ti plasmid can be used as a VECTOR to move genes into plants
Go to Section:
Go to Section:
Go to Section:
Go to Section:
1. How is the
Agrobacterium
cell used in this process?
The
Agrobacterium
into plant cells.
cell is the source of the plasmid into which a new gene is inserted. The recombinant plasmid is then introduced Go to Section:
2. What is the goal of this process?
The goal is to produce plants with desired traits.
Go to Section:
Bt Toxin genetically modifies corn
Advantage •Kills pests •No pesticides sprayed •Costs less for insecticide Disadvantage •May kill other insects EX pollen may kill passing butterflies and bees •Corn seeds cost more Go to Section:
Knockout Genes Section 13-3 Recombinant DNA
Target genes may be inserted into the Host cells DNA if the flanking sequences are the same – theses are called knock out genes.
Flanking sequences match host
Host Cell DNA Target gene
Recombinant DNA replaces target gene
Modified Host Cell DNA
Go to Section:
Go to Section:
Geneticists had taken the luciferase gene from a firefly and inserted it into a tobacco plant. This meant that when the plant was fed with luciferin the result was a plant that glows in the dark!
Go to Section:
Plucky is an albino Xenopus laevis frog expressing green fluorescent protein (GFP) in her eye. GFP is a jellyfish protein that fluoresces bright green when illuminated by blue light. GFP is used as a genetic marker appearance of a to show the
The first cloned mouse was created at UH
TRANSGENIC ORGANISM Go to Section:
Go to Section:
•GFP Amino Acids were sequenced •Then Bases for DNA were sequenced •GFP used as
GENETIC MARKER
to show that another gene has been inserted Go to Section:
•
Plant Genome Video
Go to Section:
Figure 13-13 Cloning of the First Mammal Section 13-4 Cloned Lamb
A donor cell is taken from a sheep’s udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell Egg Cell
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
The fused cell begins dividing normally.
The embryo develops normally into a lamb —Dolly
Foster Mother Embryo
The embryo is placed in the uterus of a foster mother.
Go to Section:
Go to Section:
Link to Cloning Mimi
THE FIRST MOUSE CLONES
The clones (two brown mice at bottom) are genetic duplicates of the mouse at top right, which donated its cumulous cells. They are the result of a technique perfected at the University of Hawaii in 1998 Go to Section:
WILBUR WANNABES
The first litter of cloned pigs, born in 2000 in Virginia, demonstrate that cloning could be used to generate organs for human transplant in the near future Go to Section:
Not to be outdone, Chinese researchers are perfecting cloning techniques in the hope of using the procedure to preserve the country's beloved panda species. For practice, they began with more common species, including goats like Yangyang (above). Cloning remains a tricky process; only 2%-5% of the eggs that start out as clones develop into live animals. The good news is that once they survive past the first year, clones like Yangyang, celebrating her sixth birthday, are relatively healthy. Go to Section:
Go to Section: Dr. Severino Antinori, an Italian embryologist, fires up the press in 2001 after announcing plans to clone the first human to help infertile couples have children. He claimed one of his patients was carrying a clone, but he failed to confirm his tale or produce the child. His comments launched a debate over the ethics of cloning human beings; countries like Britain and South Korea have since made it illegal to clone people, while the U.S. Congress has yet to ban the process.
Go to Section: Animation Link to PCR Animation on Web
Section 13-2 Figure 13-8 PCR
DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 DNA copies 1 2 2 3 4 4 8 5 etc.
16 etc.
Go to Section:
Section 13-2 Restriction Enzymes
Recognition sequences DNA sequence Go to Section:
Section 13-2 Restriction Enzymes
Recognition sequences DNA sequence Restriction enzyme
EcoR I
cuts the DNA into fragments.
Sticky end Go to Section:
Section 13-2 Figure 13-6 Gel Electrophoresis
DNA plus restriction enzyme Power source Mixture of DNA fragments Gel http://learn.genetics.utah.edu/units/biotech/gel/ Gel Electrophoresis simulation Longer fragments Shorter fragments Go to Section:
Go to Section:
P 373
Differences in DNA sequences on homologous chromosomes result in different restriction fragment length patterns RFLP - these may be sorted by length using gel electrophoresis
Go to Section:
Go to Section:
Different people have different DNA -DNA when cut by enzymes will leave different size fragments -which will separate into different electrophoresis patterns -a DNA fingerprint If there is only a small sample of DNA available- more copies can be made by PCR polymerase chain reaction (p371) Link to DNA Fingerprint Lab
Go to Section:
DNA Microarray Identifies Active Genes Single stranded cDNA is made from a target cell’s active mRNA and tagged with a fluorescent dye A DNA Chip is a microarray of many spots where single stranded DNA is attached – each strand representing a different gene.
If a gene is active the dye labeled cDNA will attach and cause that spot to light up when a laser strikes it.
This tells you which genes are active.
Go to Section:
Section 13-2 Figure 13-7 DNA Sequencing
Go to Section:
Section 13-3 Interest Grabber Sneaking In
You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Go to Section:
Section 13-3 Interest Grabber continued
1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer ’s memory?
2. Why would a person download a virus program?
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?
Go to Section:
Section 13-4 Interest Grabber The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Go to Section:
Section 13-4 Interest Grabber continued
1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?
Go to Section:
Flowchart Section 13-4
Cloning A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an embryo.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.
Go to Section:
Figure 13-13 Cloning of the First Mammal Section 13-4 Cloned Lamb
A donor cell is taken from a sheep’s udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell Egg Cell
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
The fused cell begins dividing normally.
The embryo develops normally into a lamb —Dolly
Foster Mother Embryo
The embryo is placed in the uterus of a foster mother.
Go to Section:
Link to Cloning Mimi Go to Section:
Go to Section:
ADA: The First Gene Therapy Trial
• A four-year old girl became the first gene therapy patient on September 14, 1990 at the NIH Clinical Center. She has adenosine deaminase (ADA) deficiency , a genetic disease which leaves her defenseless against infections. White blood cells were taken from her, and the normal genes for making adenosine deaminase were inserted into them. The corrected cells were reinjected into her. Dr. W. French Anderson helped develop this landmark clinical trial when he worked at the National Heart, Lung, and Blood Institute Go to Section:
Video
Gene Transfer Click the image to play the video segment.
Go Online
Links from the authors on genetically modified foods Interactive test For links on recombinant DNA, go to www.SciLinks.org
Web Code as follows: cbn-4132.
and enter the For links on genetic engineering, go to www.SciLinks.org
Web Code as follows: cbn-4134.
and enter the
Interest Grabber Answers
1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed. Encourage students to refer only to breeds with which they are familiar.
2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.
Additional traits might include shape of ears, shape of muzzle (pointed or square), or length of legs with respect to body.
3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.
Students will likely assume that traits of the cross-breed are intermediate between those of the two parent breeds.
Interest Grabber Answers
1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.
1 –2: Remind students to check their copies for accuracy before they begin the next step.
3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Students should find three occurrences of the sequence: GTACTAG
GTTAAC
TGTACTATC
GTTAAC
GTAAGCTAC
GTTAAC
CTA
Interest Grabber Answers
1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer ’s memory?
A file can be downloaded from a diskette, a CD, or the Internet.
2. Why would a person download a virus program?
The computer user would not willingly download a virus but would download a program that was useful.
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?
Possible answers: a useful protein or a strand of DNA that the cell would recognize and accept
Interest Grabber Answers
1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? Students may say that a mouse with a humanlike immune system would be a good laboratory model for immune research.
2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?
Transgenic organisms might disrupt normal balances in ecosystems and could breed with natural populations, changing them.
This slide is intentionally blank.