Transcript PowerPoint 演示文稿

Chapter
16
Transcription and Posttranscriptional
Processing
The term transcription in molecular biology means RNA
biosynthesis.
In 1955 Francis Crick hypothesized that there were
intermediate molecules which participated in transferring genetic information from DNA to protein.
The intermediate molecule was RNA.
In 1958 he put forth the famous central dogma.
---
--
DNA-------- RNA------ protein
-------Temin 1970
In 1961 the DNA dependent RNA polymerase was
discovered
in E coli and the study on the mechanism of transcription
began.
In 1982 Thomas Cech discovered that one of the precursor
RNA in Tetrahymena chould act as a catalyst and catalyzed
self-splicing. It is a ribozyme.
Section
1
DNA dependent RNA synthesis
RNA synthesis is catalyzed by DDRP ( or simply RNA
polymerase. )
Characteristics of RNA synthesis
Template DNA ( one strand DNA in dsDNA, template strand )
Substrate
four kinds of NTP
Enzyme
DDRP ( no reqirement of primer, no proof-reading
function )
Direction of
RNA chain
synthesis
5’ to 3’
Base pairing
rule
GC TA AU
Inorganic
ion
Mg++ Zn++
The process of transcription can be divided into three stages:
initiation, elongation and termination.
see the fig. on the blackboard
The two strands in dsDNA are complementary.
They are the coding strand and the template strand.
The template strand works as the template for the synthesis
of RNA.
The synthesized RNA is complementary to the template
strand.
Its sequence is the same as that of the coding strand with
the exception of the substitution of U for T.
eg.
5’ CGCATTAACG 3’
coding strand
3’ GCGTAATTGC 5’
template strand
5’ CGCAUUAACG 3’
RNA transcript
The Reaction
( NMP )n + NTP ---------- ( NMP )n+1 +PPi
Asymmetric Transcription
---------------
----------------
________________________________________________
________________________________________________
----------
-----------
In dsDNA one strand is coding strand. It is not transcribed.
The other strand is template strand. It is transcribed.
In a segment of dsDNA the coding information of genes may
be in different strands.
RNA polymerase
There is only one type of RNA pol in prokaryotes while
there are three types of RNA pols in eukaryotes.
E coli RNA polymerase
E coli RNA pol catalyzes synthesis of all the RNAs
( mRNA , rRNA , tRNA etc )
Structure of E coli RNA polymerase
The holoenzyme of E coli RNA pol contains α2ββ’(ω)σ subunits
The σ subunit can be dissociated from the holoenzyme.
The RNA pol without σ subunit is called core enzyme: α2ββ’(ω)
Function of the Subunit
σ can recognize promoters and initiate transcription.
α can bind regulatory proteins and control the transcriptional
rate.
β+β’ catalyzes RNA synthesis.
There may be ω subunit. Its function is unknown.
There are different kinds of σ subunits. The most common one
is σ70.
.
Eukaryotic RNA polymerases
RNA pol I
RNA pol II
RNA pol III
____________________________________________________
Product
45SrRNA
hnRNA
tRNA
synthesized ( precursor
( precursor
5SrRNA precursors
of 18S, 28S of mRNA)
snRNA
5.8S rRNAs)
____________________________________________________
Sensitivity
to
no
high
intermediate
α-amanite
____________________________________________________
Structure of Eukaryotic RNA pols
Each type of eukaryotic RNA pols contains two different large
subunits and ten odd small subunits.
The largest subunit of RNA pol II contains consensus sequence
at the carboxyl terminal called CTD.
CTD is composed of several dozens of heptad ( YSPTSPS )
repeats.
CTD Function
RNA pol II with the unphosphorylated CTD participates in
the beginning of transcriptional initiation.
During the process of intiation many Ser and some Tyr
residues of CTD are phosphorylated.
RNA pol II with the phosphorylated CTD fulfills the initiation and leaves the promoter.
RNA synthesis enters in the stage of elongation.
Prokaryotic Transcriptional Initiation
Prokaryotic RNA pol binds the promoter and initiates transcription.
Promoter : DNA sequence that is usually upstream of a gene’s
coding sequence and that RNA pol binds and initiates transcription.
σ subunit can recognize the promoter
E coli promoters extend from –70 to +30 of the initiation site (+1)
Most of them have two regions of consensus sequence , the
-35 region ( TTGACA ) and the -10 region ( Pribnow box
TATAAT ).
σ70 can recognize the consensus sequence.
Some promoters of genes with high transcriptional rate have
another consensus region , the AT-rich up-element (-40 to
-60 ) which α subunit binds.
The holoenzyme of RNA pol binds the promoter via σ subunit.
strong promoter / weak promoter
It is the -35 and -10 regions and the distance between them
and the distance between –10 region and the transcriptionnal
initiation site , that determines the transcriptional rate.
The more similar the –35 and –10 regions of a promoter to
the consensus sequences of TTGACA and TATAAT , the
stronger affinity it has for RNA pol binding.
That results in the higher transcriptional rate.
And vice versa.
Process of Prokaryotic Trancriptional Initiation
RNA pol recognizes and binds the promoter.
That forms a close transcription complex.
DNA double helix near –10 region unwinds.
That results in an open transcription complex.
Transcription begins. A triple-element complex of DNA,
RNA pol and the newly synthesized RNA forms
The formation of the triple-element complex causes conformation change.
RNA pol leaves the promoter and elongation begins.
As the elongation begins the σ subunit dissociates from
RNA pol.
It is the core enzyme of RNA pol that is responsible for
the elongation.
Eukaryotic Transcriptional Initiation
Eukaryotic RNA pols alone can not initiate transcription.
Only with the help of transcription factors can they fulfill
the task of initiation.
Transcriptional initiation of RNA pol II needs not only the
enzyme but also multiple transcription factors.
There are consensus sequences in many of the RNA pol II
recognized promoters.
They are –30 region ( TATA box ) and +1 region ( the initiation site , initiator , Inr ).
The initiation stage of RNA pol II can be divided into two
steps : the assembly step and the initiation step.
The Assembly Step
TBP ( TATA-binding protein ) binds TATA box.
TFIIB ( or with TFIIA ) binds TBP and promoter.
With the help of TFIIF , RNA pol II- TFIIF complex interactes with TFIIB and binds TFIIB and promoter.
Then TFIIE and TFIIH join them.
RNA pol II and the TFII factors form a close initiation complex on the promoter.
The Initiation Step
TFIIH has both the helicase and the kinase activities.
It unwinds dsDNA.
The close initiation complex becomes the open initiation complex.
TFIIH also catalyzes phosphorylation of CTD.
RNA pol II with phosphorylated CTD initiates transcription.
The Initiation Stage of RNA pol I or RNA pol III
The initiation stage of RNA pol I or RNA pol III is similar
to that of RNA pol II.
The transcription factors recognize and bind the promoter.
RNA pol I or RNA pol III joins them to form an initiation
complex.
Initiation begins.
Initiation Stage of RNA pol I
rDNA ( contains genes of 18 S rRNA, 28 S rRNA and 5.8 S
rRNA ) is transcribed by RNA pol I. The product is 45SrRNA
There are two consensus sequences in rDNA promoter : core
element ( +1 region ) and UCE ( upstream control element ).
Transcription factor UBF binds UCE first.
Then transcription factor SL1 binds core element.
RNA pol I joins them. They form a complex on promoter.
Initiation begins.
RNA pol III initiates transcription of 5SrRNA gene or tRNA
gene.
There are internal promoters in such genes.
Internal promoter means the promoter within the coding region
of the gene.
tRNA gene’s promoter has two consensus sequences : A box
and B box, while 5SrRNA gene’s promoter has only one consensus sequence : C box.
Transcriptional Initiation of 5SrRNA Gene
TFIIIA binds C box.
TFIIIC and TFIIIB bind TFIIIA.
RNA pol III binds them. A complex is formed.
RNA pol III initiates transcription.
Initiation RNA pol I RNA pol III RNA pol II
__________________________________________________
ATP requirement
no
no
yes
__________________________________________________
A and B or TATA box
core consensus sq. core element C box
Inr
__________________________________________________
CAAT box
upstream element UCE
GC box etc
__________________________________________________
general TFs
SL1
TFIIIA B C
various TFIIs
___________________________________________________
upstream factors
UBF
various upstream factors
_____________________________________________________
Transcriptional Termination
There are two types of transcriptional termination in prokaryotes
ρ independent and ρ dependent.
ρ independent termination
There are two characteristics of ρ independent termination sq.
( terminator ).
A segment of GC-rich , self-complementary sq.
It is followed by a series of T. eg
GCCGCCAGTTCGGCTTGCCGCCTTTT
The RNA synthesized is also self-complementary and forms
a stem-loop structure followed by aseries of U.
UU
5’ GCCGCCAG
C
CGGCGGUC
U
U
GG
U
U
U 3’
RNA pol interacts with the structure and stops at the template
The UA pairs are unstable. The newly synthesized RNA releases from the template. Transcription terminates.
ρ dependent termination
The terminator of the ρ dependent termination is not typical.
It contains CA-rich region which ρ factor can recognize.
ρ factor is a homo-hexamer protein factor , can bind the newly
synthesized RNA and moves to the RNA-DNA hybrid region.
ρ factor has helicase activity and unwinds the RNA-DNA helix
depending on the energy released from ATP hydrolysis.
Section 2 Posttranscriptional Processing
Mature eukaryotic mRNA has experienced 5’- and 3’ end
processing and splicing.
hnRNA ( or mRNA ) is capped at 5’ end
Most hnRNA have a cap of 7-methylguanosine triphosphate
( m7Gppp-) at the 5’ end.
It is added to the 5’ end of the growing transcript of 25-30
nucleotides via 5’5’ triphosphate linkage.
The cap protects hnRNA ( and mRNA ) from Rnase attack
and participates in the binding of mRNA and ribosome.
hnRNA ( or mRNA ) has a poly A tail at the 3’end
Almost all of eukaryotic hnRNAs ( or mRNAs ) have a poly A
tail of 80-250 nucleotides at the 3’end.
It is enzymatically added to the primary transcript intwo stages.
Cleavage
The transcript is cleaved 10 to 30 nucleotides past a highly
conserved AAUAAA sq ( the polyadenylation signal sq )
and within 50 nucleotides before a GU-rich sq.
10-30nts < 50nts
-----------AAUAAA----------------I-------------------GU-rich—
cleavage site
Polyadenylation
The poly A tail is subsequently generated from ATP through
stepwise action of poly A polymerase.
Multiple enzymes and protein factors participate in the two
stages.
Splicing.
Split Gene , Exon and Intron
Eukaryotic genes consist of alternating coding and noncoding sequences. In other words the coding sq of eukaryotic genes is not continuous.
They are split genes. The coding sq in the split gene is
called the exon, the non-coding sq, the intron.
hnRNA is co-linear to its template DNA except the cap and
the tail.
It also contains alternating exons and introns.
The coding sq of mRNA is continuous.
hnRNA following excision of introns and connection of
exons becomes mRNA. This process is called splicing.
The Mechanism of Splicing
There are consensus sequences at the junctions of exon and
intron . They are called splice sites.
The shortest splice sites at the 5’ end ( splice donor ) and 3’
end ( splice acceptor ) of the intron are GU and AG respectively.
Upstream of AG there is a branch point A .
exon 1
intron
exon 2
========GU-----------------------A-----AG=============
splice donor
branch point splice acceptor
The branch point A initiates nucleophilic attack at the 5’end
of the intron. It is the first transesterification reaction.
-----------------=========GU-----------------A-------AG=============
Exon1 is released. Intron forms a lariat.
-----G
==========OH
-----A------AG=============
The 3’end of exon 1 initiates nucleophilic attack at the 3’ end
of the intron. It is the second transesterification reaction.
===========OH >
G
-----A------AG=============
Exon1 and exon2 are connected. Lariat form of intron is released. Splicing is completed.
============ =================
G
-----A------AG
The previously described splicing takes place in the spliceosome.
Spliceosome contains snRNPs which are composed of snRNAs
and proteins.
snRNAs in snRNPs are U-rich, and called URNAs.
There are 5 URNAs.
.The process of splicing in the spliceosome includes spliceosome assembly, spliceosome activation and splicing
An eukaryotic gene may direct transcription of different
hnRNAs from different promoters or using different polyadenylation sites.
There are two promoters in glucokinase gene.
In the liver cell transcription initiates from the second promoter which is near the coding sq, while in the pancreatic β
cell transcription initiates from the first promoter which is
upstream located.
This is an example that one gene can express different
hnRNAs ( and mRNAs ).
In the different developmental stages of lymphocyte B
3’ end processing of the hnRNA of μ chain can use different polyadenylation sites and yield different hnRNAS
( and mRNA )
This is another example.
Alternative Splicing Provides for
Different mRNAs from the Same hnRNA
The mechanism of alternative splicing includes the selective
inclusion or exclusion of exons, the use of alternative 5’donor or 3’ acceptor sites.
exon1
exon2
exon3
========-----------=====-------=============hnRNA
splicing1 (mRNA1)
exon1 exon2
======== =====
splicing2 (mRNA2)
exon2
exon3
===== =============
splicing3 (mRNA3)
exson1 exon2 exon3
======== ===== ==============
hnRNA
===========-------======------------===============
2 donor sites in exon1
2 acceptor sites in exon3
3mRNAs
=========== ====== ============== exon 1+2+3
====== ====== ============== part of exon 1+e2+e3
=========== ====== ====== e1+e2+ part of exon 3
rRNA precursor processing requires Rnases
prokaryotic 30SrRNA precursor----
methylation ---- Rnases cut ----
precursors of 23SrRNA, 16SrRNA 5SrRNA
and tRNA---- Rnases cut ---- 23SrRNA
16SrRNA , 5SrRNA and tRNA
eukaryotic 45SrRNA precursor----methylation
-----snoRNP mediated processing----precursors
of 18SrRNA , 28SrRNA , 5.8SrRNA ----snoRNP
mediated processing ---- 18SrRNA , 28SrRNA ,
5.8SrRNA
tRNA precursor processing
tRNA precursor processing in prokaryotes and eukaryotes
are similar.
It includes 5’end cutting
3’end cutting and CCA adding (if there isn’t CCA)
splicing (if there is intron , splicing takes place via
enzymatic cutting and joining)
base modification.
Self-splicing Catalyzed by RNA
In 1982 T. Cech discovered that the intronof Tetrahymena
rRNA precursor could catalyzed self-splicing.
The intron that can catalyze self-splicing belongs to the group
I intron.
Group I intron catalyzes self-splicing with the help of cofactor
guanosine or guanosine phosphate
The self-splicing includes two transesterfication reactions
5’=============---------------------==============3’
exon 1
exon 2
5’=============----------------------==============3’
G-OH
G-OH attacks the first nucleotide at the 5’end of the intron.
Exon 1 is released.
5’=============OH
G--------------------============3’
Exon 1’s 3’end attacks the nucleotide at the 3’ end of the
intron.
G----------------=================3’
5’==============OH
Two exons are connected. The intron is released.
5’============== ==================3’
G---------------OH
There are group II introns , which can also catalyze selfsplicing.
They catalyze self-splicing just like the previously mentioned
lariat-form splicing.
It also includes two transesterification reactions but does not
take place in spliceosome and does not require any cofactor.
Group I and group II introns are ribozymes.
Some mRNAs Undergo Editing
Coding information can be changed at the mRNA level by
RNA editing.
In such cases the coding sq of the mRNA differs from that
in the cognat DNA.
RNA editing is discovered first in protozoan and mediated
by g-RNA.
Some nucleotides can be changed in or added into or
deleted from the mRNA coding sq by RNA editing.
That results in change of the genetic codon and / or the
reading frame of the coding sq.
The expressed protein is changed.
An example of human RNA editing is the apolipoprotein
B mRNA.
In liver the single apoB gene is transcribed into an mRNA
that directs the synthesis of a 100 Kda protein .
In the intestine the same gene directs the synthesis of the
primary transcript however acytidine deamination converts
a CAA codon in the mRNA to UAA at a single specific
site.
Rather than encoding glutamine this codon becomes stop
codon and a 48 Kda protein is the result.
Section 3 RNA dependent RNA synthesis
RNA as genetic material
All plant viruses, several bacteriophages and many animal
viruses have genomes consisting of RNA.
There are three types of RNA genomes : dsRNA, ssRNA
and two copies of the same ssRNA.
The dsRNA and ssRNA are replicated by RNA replicase
( RNA dependent RNA polymerase, RDRP ).
In most cases RNA genome is single stranded.
There are two subtypes of ssRNA genomes the +ssRNA
and the –ssRNA.
+ssRNA genome functions both as genetic material and
mRNA, while –ssRNA genome serves only as genetic
material.
Viruses with ssRNA genomes use the ssRNA as a template
for the synthesis of a complement strand , which can then
serve as template in replicating the original strand.
Retroviruses have two copies of the same ssRNA as the
genome.
They carry the reverse transcriptase.
It has three enzymatic activities : RDDP , DDDP and Rnase H