Transcript Document
Protein Synthesis Making Proteins Regents Biology 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA Regents Biology DNA Cells Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA Regents Biology DNA Proteins Cells Bodies ____________________________________ _____________ proteins cells Regents Biology bodies DNA gets all the glory, Proteins do all the work How do proteins do all the work ____________________ proteins run living organisms __________________ control all chemical reactions in living organisms __________________ all living organisms are built out of proteins Regents Biology Cell organization DNA ________________________ genes = instructions for making proteins want to keep it there = protected “locked in the vault” nucleus Regents Biology nucleus Cell organization Proteins aa aa aa ___________________________ aa ________________________________________ aa ___________________________ aa cytoplasm aa aa aa aa build proteins nucleus nucleus Regents Biology aa Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm ___________________________ ___________________________ cytoplasm aa aa aa aa aa aa aa aa aa build proteins nucleus nucleus ribosome Regents Biology aa From nucleus to cytoplasm aa aa aa aa aa ______________ DNA mRNA aa aa aa protein aa ________________ trait nucleus Regents Biology cytoplasm DNA vs. RNA _______ deoxyribose sugar nitrogen bases _____________ _____________ C:G ________________ Regents Biology _______ ribose sugar nitrogen bases _____________ _____________ C:G ________________ Transcription _____________________ DNA strand is the template (pattern) match bases U:A G:C Enzyme RNA polymerase Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Matching bases of DNA & RNA Match RNA bases to DNA C G bases on one of the DNA strands U A G G U U C A AG A C G A U A C RNA A C C polymerase G A U T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology U C Matching bases of DNA & RNA U instead of T is matched to A aa aa aa DNA TACGCACATTTACGTACGCGG aa aa mRNA aa AUGCGUGUAAAUGCAUGCGCC aa aa aa aa ribosome A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology cytoplasm aa aa aa aa aa aa proteinaa aa aa aa nucleus ribosome A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology trait How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm ____________________________________ How? mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa Regents Biology aa aa aa aa aa aa aa How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa Regents Biology aa aa aa aa aa aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? aa mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codons mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala ________________________________ Regents Biology The mRNA code For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, Regents Biology UAA, UAG How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC codon tRNA amino acid UAC Met GCA Arg CAU anti-codon Val ________________________________ Regents Biology mRNA to protein = Translation __________________________________ __________________________________ __________________________________ ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG tRNA aa aa aa Regents Biology U A C tRNA aa A G C tRNA U A G aa tRNA aa From gene to protein aa aa _______________ DNA _______________ aa aa protein aa mRNA aa aa ribosome A C C A U G U C G A U C A GU A GC A U GGC A nucleus Regents Biology tRNA cytoplasm aa trait cytoplasm aa aa transcription aa aa aa transcription transcription aa aa aa aa aa aa nucleus Regents Biology transcription From gene to protein protein transcription Regents Biology translation Whoops! See what happens when your genes don’t work right! Any Questions?? Regents Biology 2009-2010