Transcript Slide 1
FUSARIUM STRAIN IDENTIFICATION IN DIFFERENT WHEAT SAMPLES COLLECTED FROM DIFFERENT REGIONS FROM THE WEST PART OF ROMANIA Fusarium graminearum, Fusarium culmorum two chemotaxonomic groups based on production of trichothecenes: Deoxynivalenol (DON) and Nivalenol (NIV) Fusarium verticillioides and Fusarium proliferatum Fumonisin TRICHOTHECENES ARE BIOSYNTHESIZED IN A COMPLEX PATHWAY INVOLVING A SERIES OF OXYGENATION, ISOMERIZATION, AND ESTERIFICATION STEPS Many of the trichothecene biosynthesis genes are localized in a gene cluster of at least 10 genes. The genes in this cluster include the genes for: •trichodiene synthetase (Tri5) •P450 oxygenase (Tri4 and Tri11) •acetyltransferase (Tri3 and Tri7) •transcription factors (Tri6 and Tri10) •a toxin efflux pump (Tri12) •two unidentified hypothetical proteins (Tri8 and Tri9) •another acetyltransferase gene (Tri101) is unlinked to the cluster •the genes Tri13 and Tri14, were found to be under the control of Tri10, but the functions of these genes are not known Primers for the toxin genes Specie Primers sequence Amplicon size (bp) Tri 7 DON biosynthetic gene 5’ TGCGTGGCAATATCTTCTTCCTA 3’ 3’ GTGCTAATATTGTGCTAATATTGTGC 5’ Tri 13 DON biosynthetic gene 5’ CATCATGAGACTTGTGTCAGAGTTTGGG 3’ 3’ GCTAGATCGATTGTTGCATTGAG 5’ 282 Tri 7 NIV biosynthetic gene 5’ TGCGTGGCAATATCTTCTTCTA 3’ 3’ GGTTCAAGTAACGTTCGACAATAG 5’ 465 Tri13 NIV biosynthetic gene 5’ CCAAATCCGAAAACCGCAG 3’ 3‘ TTGAAAGCTCCAATGTCGTG 5’ 312 FUM 1(PQF5) fumonisin biosynthetic gene 5’ GAGCCGAGTCAGCAAGGATT 3’ 3’ AGGGTTCGTGAGCCAAGGA 5’ 60 381-445 THE TOXIN LEVEL IN CONVENTIONAL AND GMO MAIZE – in previous years The DON level in conventional and GMO maize seeds - 2009 The fumonisin level in conventional and GMO maize seeds - 2009 DON 2008 –– low levels for GMO (114,91µg/kg) and conventional (127.09 µg/kg) maize 2009 – the average level for DON was 25 times higher (971,44 µg/kg) compared to GMO (38,59 µg/kg) FUMONISIN The differences between conventional corn (800 µg/kg) and Bt (512,8 µg/kg) were lower in 2008, compared to 2009 - 1162,01 µg/kg for conventional maize and 462,8 µg/kg for GMO. Significant variation of the mycotoxins concentration among places, years and genotypes has been reported in other countries, too MAIZE – conventional and genetically modified - 2010 Fusarium DETECTION 1-4 conventional maize 1 2 3 4 5 PC 5- Bt (GMO) maize Fusarium culmorum Fusarium graminearum 1 2 3 4 600 bp 5 PC NC Fusarium verticiloides - negatives Fusarium proliferatum TOXIN GENES DETECTION TRI 13 DON 1 TRI 7 DON 1 2 3 4 5 PC TRI 7 NIV - negative PQF5 – fumonisin - negative 2 3 4 5 PC WHEAT SAMPLES, collected from last year’s harvest 1 – Fizes Caras Severin county 2 – Sacalaz – Timis county 3 – Beregsau Mare – Timis county 4 – Becicherecu Mic – Timis county 5 – Pecica – Arad county 6 – Ineu – Arad county 7- Barsa – Arad county Fusarium proliferatum Fusarium DETECTION 1 2 3 4 4 5 5 6 Fusarium graminearum 1 2 3 4 5 6 7 1 2 3 Fusarium verticiloides - negatives Fusarium culmorum 6 7 7 TRI 7 DON TOXIN GENES DETECTION 1 2 3 4 5 6 7 TRI 13 DON 1 2 3 4 5 6 TRI 7 NIV 1 2 3 4 5 6 7 PQF5 – fumonisin - negative 7 The Fusarium presence and toxin producing genes 1 2 3 4 5 6 7 Sample Fg Fc Fizes - Caras Severin county Sacalaz – Timis county Beregsau Mare – Timis county Becicherecu Mic – Timis county Pecica – Arad county Ineu – Arad county Barsa – Arad county + + + + + + + - Fp + Fv - TRI 7 DON + + + + + + + TRI 13 DON + + + + + + TRI 7 NIV + + + - PQF5 - In general, both DON and NIV chemotypes were reported in Africa, Asia and Europe, while only the DON chemotype was found in the USA THE HEAVY METALS INFLUENCE ON TWO ALFALFA GENOTYPES – A SENSITIVE AND A TOLERANT ONE Germination on moistened filter paper The plantlets were transferred in pots (1 week) The metal treatments were applied after 1 month Pb and Cd Cu and Fe First experimental serie Untreated - control Pb 50 Cd 1 Cu 100 Fe 100 100 3 250 250 250 10 500 500 500 20 The Cu and Fe concentration were too high Pb Pb Cd Cd Cu Fe Cu Fe Second experimental serie (ppm concentration) Untreated - control Pb 50 Cd 1 Cu 5 Fe 5 100 3 10 10 250 10 50 50 Two month treatment SIGMA SATELIT The significance of differences between different variants applied to Sigma alfalfa cultivar No. Variants Growth rate (%) after 1 week 1 Control 2 Pb 50 3 Pb 100 4 Pb 250 5 Cd 1 6 Cd 3 7 Cd 10 8 Cu 5 9 Cu 10 10 Cu 50 11 Fe 5 12 Fe 10 13 Fe 50 Exp. mean LSD 5% 25.97 125.95+7.84 131.92+11.16 148.09+11.97 138.49+14.74 153.79+11.37 163.95+13.99 150.96+15.67 152.41+18.04 137.04+14.50 125.12+7.06 158.4+12.86 150.61+12.17 144.48+12.36 144.71+9.12 LSD 1% 34.27 To experimental mean Relative Differ./ value (%) Signiff. 87.04 -18.76 91.16 -12.79 102.34 3.38 95.70 -6.22 106.28 9.08 113.30 19.24 104.32 6.25 105.32 7.70 94.70 -7.67 86.46 -19.59 109.46 13.69 104.08 5.90 99.84 -0.23 100.00 Control SIGMA To control Relative value (%) 100.00 104.74 117.58 109.96 122.10 130.17 119.86 121.01 108.81 99.34 125.76 119.58 114.71 114.89 Differ./ Signiff. Control 5.97 22.14 12.54 27.84* 38.00** 25.01 26.46* 11.09 -0.83 32.45* 24.66 18.53 18.76 One week LSD 0.1 % 44.02 The highest values of the growth rate with statistic significance were observed after one week for the variants: Cd 3 (38,00**); Fe 5 (32,45*); Cd 1 (27,84*) şi Cu 5 (26,46*). The significance of differences between different variants applied to Sigma alfalfa cultivar No. Growth rate (%) Variants after 1 month 1 2 3 4 5 6 7 8 9 10 11 12 13 Control Pb 50 Pb 100 Pb 250 Cd 1 Cd 3 Cd 10 Cu 5 Cu 10 Cu 50 Fe 5 Fe 10 Fe 50 Exp. mean LSD 5% 42.59 152.59+11.66 151.88+13.56 162.43+13.85 150.71+14.99 174.85+13.79 189.77+20.56 192.35+22.81 183.19+20.94 145.82+16.24 0.00+0.00 224.59+28.11 203.54+21.94 185.52+20.79 162.86+15.05 To experimental To control mean Relative Differ./ Relative Differ./ value (%) Signiff. value (%) Signiff. 93.69 -10.27 100.00 Control 93.26 -10.98 99.53 -0.71 99.74 -0.43 106.45 9.84 92.54 -12.15 98.77 -1.88 107.36 11.99 114.59 22.26 116.52 26.91 124.37 37.18 118.11 29.49 126.06 39.76 112.48 20.33 120.05 30.60 89.54 -17.04 95.56 -6.77 0.00 -162.86000 0.00 -152.59000 137.90 61.73** 147.19 72.00** 124.98 40.68 133.39 50.95* 113.91 22.66 121.58 32.93 100.00 Control 106.73 10.27 One month Compared to the untreated variant, after one month treatment a superior growth rate was pointed out for all of the variants, except the variants Pb50, Pb250, Cu 10 and Cu 50. The growth was statistical significant only for Fe 5 and Fe 10. LSD 1% LSD 0.1 % 56.21 72.21 Compared to the untreated variant, a positive evolution of the growth rate was pointed out for the Fe 5, Cd10 and Cu 5 variants, the increasing being statistically significant only for Fe 5 variant. 250 225 204 200 152 162 163 151 146 150 148 126 132 186 183 175 153 164 154 151 158 152 138 137 151 144 145 125 100 1week 1month 50 Fe 10 Fe 5 Fe 50 C u 10 C 50 Ex p. m ea n Variants u 5 u C 10 C d 3 d C C d 1 0 on tro l Pb 50 Pb 10 0 Pb 25 0 0 C Growth rate (%) 192 190 Growth rate after 1 week and 1 month after treatment with different metals of Sigma alfalfa cultivar The significance of differences between different variants applied to Satelit alfalfa cultivar One week No. Growth rate To experimental mean To control Variants (%) Relative Differ./ Relative Differ./ after 1 week value (%) Signiff. value (%) Signiff. 1 Control 120.68+6.58 88.89 -15.09 100.00 Control 2 Pb 50 159.80+25.99 117.70 24.03 132.42 39.12** 3 Pb 100 108.60+8.44 79.99 -27.17 89.99 -12.08 4 Pb 250 120.65+9.10 88.86 -15.12 99.98 -0.03 5 Cd 1 141.81+19.05 104.45 6.04 117.51 21.13 6 Cd 3 152.27+16.58 112.15 16.50 126.18 31.59* 7 Cd 10 145.30+14.39 107.02 9.53 120.40 24.62 8 Cu 5 158.87+22.57 117.01 23.10 131.65 38.19* 9 Cu 10 111.89+6.73 82.41 -23.88 92.72 -8.79 10 Cu 50 137.87+28.93 101.55 2.10 114.24 17.19 Exp. 135.77+6.03 100.00 Control 112.51 15.09 mean LSD 5% 29.19 LSD 1% LSD 0.1 % 38.52 49.48 Compared to the untreated variant, most of the variants, except Pb 100, Pb 250 şi Cu 10, had a positive influence on the growth rate. The highest values, statistically significant, were pointed out for the variants Pb50 (39,12**), Cu 5 (38,19*) şi Cd 3 (31,59*). The significance of differences between different variants applied to Satelit alfalfa cultivar One month No. Variant s 1 2 3 4 5 6 7 8 9 10 Control Pb 50 Pb 100 Pb 250 Cd 1 Cd 3 Cd 10 Cu 5 Cu 10 Cu 50 Exp. mean LSD 5% 44.73 Growth rate (%) To experimental mean after 1 month Relative value (%) Differ./ Signiff. 153.54+21.44 171.66+18.71 203.57+32.56 172.30+19.08 177.37+21.03 201.41+26.06 169.32+15.09 211.90+30.14 140.85+12.83 0.00+0.00 95.85 107.16 127.08 107.56 110.72 125.73 105.70 132.28 87.93 0.00 -6.65 11.47 43.38 12.11 17.18 41.22 9.13 51.71* -19.34 -160.19000 160.19+19.14 100.00 Control LSD 1% LSD 0.1 % 59.03 75.83 To control Relative Differ./ value Signiff. (%) 100.00 Control 111.80 18.12 132.58 50.03* 112.22 18.76 115.52 23.83 131.18 47.87* 110.28 15.78 138.01 58.36* 91.74 -12.69 0.00 -153.54000 104.33 Compared to the untreated variant, a superior growth rate was pointed out for all of the variants, except Cu 10. The highest values, statistically significant were register for the variants: Cu 5 (58,36*); Pb 100 (50,03*) şi Cd 3 (47,87*). 6.65 Compared to the experience mean, all the treatments, except Pb 50 and the control, had a positive and progressive effect in time.The same trend was observed compared to the untreated variant, too. 250 211.9 203.57 200 1week 201.41 1month 172.3 177.37 171.66 169.32 Growth rate (%) 153.54 140.85 150 159.8 152.27 100 120.68 158.87 145.3 141.81 160.19 137.87 135.77 120.65 111.89 108.6 50 0 n m ea 50 Ex p. C u u 10 5 u C d C Variants C 10 3 C d 1 d C 25 0 Pb 10 0 Pb 50 Pb C on tro l 0 Growth rate after 1 week and 1 month after treatment with different metals of Satelit alfalfa cultivar 170 163.95 Sigma 160 159.8 158.87 Satelit 153.79 Growth rate (%) 150 152.27 150.96 152.41 148.09 145.3 141.81 140 137.87 138.49 137.04 131.92 130 125.95 120 110 120.68 125.12 120.65 111.89 108.6 100 Control Pb 50 Pb 100 Pb 250 Cd 1 Cd 3 Cd 10 Cu 5 Cu 10 Cu 50 Variants Growth rate for studied alfalfa cultivar 1 week after treatment with different metals Considering the interaction genotype x treatment, after one week treatment we observed significant differences between the growth rate of the two alfalfa genotypes for the following treatments: Pb 50, Pb 100, Pb 250 şi Cu 10. 220 212 204 200 Sigma 201 192 Satelit Growth rate (%) 190 183 180 172 172 177 175 169 162 160 154 153 152 151 146 141 140 120 100 Control Pb 50 Pb 100 Pb 250 Cd 1 Cd 3 Variants Cd 10 Cu 5 Cu 10 Cu 50 Growth rate for studied alfalfa cultivar 1 month after treatment with different metals After one month treatment the effect of the interaction genotype x treatment on the growth rate was reduced, statistically significant differences being observed only for Pb 100 and Cu 5 variants. THANK YOU FOR YOUR ATTENTION !