Plexor Systems for Quantitative Amplification

• Existing methods – gain of fluorescence Cycle Threshold

Yes, It’s Different…Yet Familiar • Plexor™ Method – quenching of fluoresence Threshold Cycle

Novel Base-Pairing Drives Plexor Technology • IsoC & IsoG dNTPs recognized by DNA Polymerase • IsoC & IsoG bases do not base pair with ACGTU • Designed and licensed from EraGen Biosciences

G isoG C isoC

Johnson, S.C.,

et al.

(2004) Nucleic Acids Res. 32 , 1937-41.

Use of IsoG & IsoC in Real-Time • Oligo primer tagged at the 5’ end with novel base (isoC) – Oligo also end-labeled with a fluor – Could be FAM, JOE, HEX, ROX; customer’s choice • Amplification master mix contains standard dNTPs and a dabcyl-labeled complementary iso-dGTP • Dabcyl-iso-dGTP incorporated opposite isoC and quenches fluorescence Sherrill, C.B.,

et al.

(2004) J. Amer. Chem. Soc. 126 , 4550-6.

Monoplex One-step RT-PCR Detection of Kanamycin 1.6 Kb synthetic transcript RNA (323 base pair amplicon) 10-fold dilutions Background of 10ng human total RNA 200,000 20,000 2,000 200 20 I

nstrument: ABI 7700

Duplex One-step RT-PCR Detection of Kanamycin 1.6kb synthetic transcript RNA (323 base pair amplicon) 10-fold dilutions Background of 10ng human total RNA •

Kanamycin (FAM) primers

•

GAPDH (JOE) primers

200,000 20,000 2,000 200 20 FAM Channel

Instrument: ABI 7700

Melt Curves • Confirmation of specificity

Monoplex FAM Monoplex JOE

Duplex FAM Channel

Monoplex One-step RT-PCR 2,000,000 copies per reaction 200,000 20,000 10,000 5,000 2,500 1,250 625 313 156 78 39 20 10 5 detected but not discriminated from 10 copy C t

Kanamycin RNA Transcript – 96 base pair amplicon

4-Color Multiplexing

Experimental details • 2-step RT-PCR • Four primer sets • All targets are human cDNA • Performed on the ABI ® 7500

2-Step qRT-PCR — 4-Color Multiplexing

Quasar™ 670

b

-actin

[100nM] Δ=0.1 cycles

Cal Fluor™ Red 610

GAPDH

[100nM] Δ=0.1 cycles Red = Monoplex Blue = 4-Plex ABI ® 7500

Cal Fluor™ Orange 560

NM_000604

[200nM] Δ=0.5 cycles

FAM

NM_001055

[200nM] Δ=0.7 cycles

Multiplexing saves time and money

Monoplex Method of Assaying Multiple Targets 1 Target + 1 Control

Target 1 Control

2 Targets + 1 Control

Target 2

3 Targets + 1 Control

Target 3

Plexor™ Method of Assaying Multiple Targets 1 Target + 1 Control 2 Targets + 1 Control 3 Targets + 1 Control Figure 1. Comparison of wells needed by each system for multiple targets.

Applications of the new technology

Gene Expression Analysis, SNP Genotyping

Genotyping Primer Design Extra Sequence to get Tm = 60 °C Core sequence Tm =50 °C ACGTAGATTGCCAATAGAT

G

ACTGTTACGACGTAGATTGCCAATAGAT

G

Allele 1 Genotyping primer Allele 1 Sequence Extra Sequence to get Tm = 60 °C Core sequence Tm =50 °C GACGTAGATTGCCAATAGAT

T

ACTGTTACGACGTAGATTGCCAATAGAT

T

Allele 2 Genotyping primer Allele 2 Sequence

Plexor Technology in Research Plexor Assay Design Plexor Reaction Plexor Data Analysis

Plexor™ Primer Design Website • Free access (registration required) Select Instrument Choose Oligo Manufacturer Input Target Sequence Choose Fluorescent Reporter Engineered for Multiplex Reaction Design

Plexor Technology in Research Plexor Assay Design Plexor Reaction Plexor Data Analysis

Plexor Systems • qPCR System – For real-time quantitation from genomic DNA, SNP genotyping – For 2-step qRT-PCR methods with your cDNA • 2-step qRT-PCR System – RT Reagents for cDNA synthesis – Plexor Master Mix for qPCR from cDNA template • 1-step qRT-PCR System – Combines RT with Plexor Master Mix for qRT-PCR directly from RNA template

Plexor Reactions • 25µl standard reaction • 2X Plexor Master Mix contains: – Enzyme – High performance buffer – Proprietary primer-dimer inhibitor – dATP, dCTP, dGTP, dTTP and Dabcyl-iso-dGTP For amplification of the DNA sequence of interest For incorporation opposite the iso-dC in the Plexor Primer and quenching of the fluorescent reporter

Plexor Technology in Research Plexor Assay Design Plexor Reaction Plexor Data Analysis

Plexor™ Analysis Software Desktop

Supported Instruments Plexor Reagents and Data Analysis Software ready for: • ABI PRISM ® 7000 • ABI PRISM ® 7700 • ABI ® 7500 • ABI ® 7900 • Roche LightCycler™ 1, 1.5 & 2 • BioRad iCycler™ • MJ Opticon ® 2 • Cepheid SmartCycler ® II • • Stratagene MX3000

et al.

Plexor advantages • Simple assay design: two primer system • Specificity from novel base pairing • Multiplexing up to 4 targets – Saves time – Saves money • Compatible with many real time PCR instruments • Free web tools for multiplex primer design and data analysis