Transcript Document

More “What Perl can do” With an introduction to BioPerl

Ian Donaldson Biotechnology Centre of Oslo IMBV 3070

Much of the material in this lecture is from the “Perl” lecture and lab developed for the Canadian Bioinformatics Workshops by Will Hsiao Sohrab Shah Sanja Rogic And released under the Creative Commons license

http://creativecommons.org/licenses/by-sa/2.5/

More “What can Perl do”

• So far, we’ve had a very brief introduction to Perl • Next, we want to go a little deeper into • Use of “strict” • Perl regular expressions • Modules • An introduction to object-oriented Perl and • BioPerl

strict

Effects of “use strict”

• Requires you to declare variables Correct my $DNA; $DNA = “ATCG”; or my $DNA = “ATCG”; Incorrect $DNA = “ATCG”; • Warns you about possible typos in variables No warning Warning my $DNA = “ATCG”; $DNA =~tr/ATCG/TAGC/ my $DNA = “ATCG”; $DAN =~tr/ATCG/TAGC

Why bother “use strict”

• Enforces some good programming rules • Helps to prevent silly errors • Makes trouble shooting your program easier • Becomes essential as your code becomes longer • We will use strict in all the code you see today and in your assignment • Bottom line: ALWAYS use strict

Write a program that has one function.

Exercise 12 Use a variable named “$some_variable” in this function and in the main body of the program.

Prove that you can alter the value of $some_variable in the function without changing the value of $some_variable in the the main body of the program.

Try it yourself (15 minutes) then check the answer at the end of this lecture.

regular expressions

What is a Regular Expression?

• REGEX provides pattern matching ability • Tells you whether a string contains a pattern or not (Note: it’s a yes or no question!) “My dog ate my homework” “Yesterday I saw a big black dog” Dog! Human’s best friend “I have a golden retriever” Regular Expression looking for “dog” “Yes” or “True” “Yes” or “True” “No” or “False” “No” since REGEX is case sensitive

Regular expressions are “regular”

Look at these names for yeast open reading frame names.

YDR0001W YDR4567C YAL0045W YBL0008C

While they are all different, they all follow a pattern (or regular expression).

1. Y means yeast 2. some letter between A and L represent a chromosome 3. an ‘R’ or ‘L’ 4. a four digit number refers to an open reading frame 5. A refers to an arm of the chromosome ‘W’ or a ‘C’ refers to either the Watson or Crick strand

Perl REGEX example

my $text = “The dog ate my homework”; if ($text =~ m/dog/){ print “The text contains a dog\n”; } • =~ m is the binding operator. It says: “does the string on the left contain the pattern on the right?” • / dog / is my pattern or regular expression • The matching operation results in a true or false answer

Regular Expressions in Perl

• A pattern that match only one string is not very useful!

• We need symbols to represent classes of characters • For example, say you wanted to recognize ‘Dog’ or ‘dog’ as being instances of the same thing • REGEX is its own little language inside Perl – Has different syntax and symbols!

– Symbols which you have used in perl such as $ . { } [ ] have totally different meanings in REGEX

REGEX Metacharacters

• Metacharacters allow a pattern to match different strings – Wildcards are examples of metacharacters – /.og/ will match “dog”, “log”, “tog”, “ og”, etc.

– So . Means “any character” – Perl REGEX has much more powerful metacharacters used to represent classes of characters

.

[ ] \t , \s , \n

Types of Metacharacters

matches any one character or space except “\n” denotes a selection of characters and matches ONE of the characters in the selection. What does [ATCG] match?

match a tab, a space and a newline respectively \w \d \D matches any characters in [a-zA-Z0-9] matches [0-9] matches anything except [0-9]

Using metacharacters to build a regular expression

Y

B

L

3456

W / Y

[A-L]

[RL]

\d\d\d\d

[WC] /

Is this a good pattern for a yeast ORF name?

What else does it match?

What if the name only has 3 digits?

REGEX Quantifiers

• What if you want to match a character more than once?

• What if you want to match an a polyA tail mRNA with that is at least 5 – 12 A’s? “ ATG ……

AAAAAAAAAAA

”

REGEX Quantifiers

“ ATG …… AAAAAAAAAAA ”

/

ATG

[ATCG]+ A{5,12} /

• + matches one or more copies of the previous character • * matches zero or more copies of the previous character • ? matches zero or one copy of the previous character • {min,max} matches a number of copies within the specified range

REGEX Anchors

• The previous pattern is not strictly correct because: – It’ll match a string that doesn’t start with ATG – It’ll match a string that doesn’t end with poly A’s • Anchors tell REGEX that a pattern must occur at the beginning or at the end of a string

REGEX Anchors

• ^

start of a string

• $

anchors the pattern to the anchors the pattern to the end of a string

/

^

ATG[ATCG]+A{5,12}

$

/

REGEX is greedy!

• The revised pattern is still incorrect because – It’ll match a string that has more than 12 A’s at the end • quantifiers will try to match as many copies of a sub-pattern as possible!

/^ ATG [ATCG]+ A{5,12} $/

“ATGGCCCGGCCTTTCCCAAAAAAAAAAAA” “ ATG GCCCGGCCTTTCCCAAAAAAA AAAAA ”

Curb that Greed!

• ?

after a quantifier prevents REGEX from being greedy

/^ ATG [ATCG]+?

A{5,12} $/

“ ATG GCCCGGCCTTTCCGAAAAAAA AAAAA ” “ ATG GCCCGGCCTTTCCG AAAAAAAAAAAA ” • note this is the second use of the question mark what is the other use of ? in REGEX?

REGEX Capture

• What if you want to keep the part of a string that matches to your pattern?

• Use ( ) “memory parentheses”

“ATG GCCCGGCCTTTCCG AAAAAAAAAAAA”

/^ATG

(

[ATCG]+?

)

A{5,12}$/

REGEX Capture /^ATG

(

[ATCG]+?

) (

A{5,12}

)

$/

$1 $2 • What’s inside the first ( ) is assigned to $1 • What’s inside the Second ( ) is $2 and so on • So $2 eq “AAAAAAAAAAAA”

REGEX Modifiers

• Modifiers come after a pattern and affect the entire pattern • You have seen //g already which does global matching (/T/g) and global replacement(s/T/U/g) • Other useful modifiers: //i //s //m ///e make pattern case insensitive let . match newline let ^ and $ (anchors) match next to embedded newline allow the replacement string to be a perl statement

REGEX Summary

• REGEX is its own little language!!!

• REGEX is one of the main strengths of Perl • To learn more: • Learning Perl (3 rd ed.) Chapters 7, 8, 9 • Programming Perl (3 rd ed.) Chapter 5 • Mastering Regular Expression (2 nd ed.) • http://www.perl.com/doc/manual/html/pod/perlre.html

• A good cheat sheet is: http://www.biotek.uio.no/EMBNET/guides/guideRegExp.pdf

Exercise 13 In a text file, write out three strings that match the following regular expression /^ATG?C*[ATCG]+?A{3,10}$/ Write a program that reads each string from the text file and checks your answers.

Try it yourself (30 min) then look at the answer at the end of this lecture.

modules

What are Modules

• a “logical” collection of functions • Using modules has the same advantage as using functions; i.e., it simplifies code (makes it modular) and facilitates code reuse • Each collection (or module) has its own “name space” Name space: a table containing the names of variables and functions used in your code

Why Use Modules?

• There are a lot of Perl modules.

Finding out what modules you already have

In Perl, each module is a file stored in some directory in your system.

The system that this class is using, stores Perl modules (like cgi.pm) in one of two directories C:\bin\Perl\lib C:\bin\Perl\site\lib

Finding out what modules you already have

• To find out where modules are installed, type perl –V at the command prompt • To find out what is installed, type perldoc perllocal at the command prompt.

Using Modules

• To use a module, you need to include the line: use modulename; at the beginning of your program.

• But you already knew that… use strict; use warnings;

Where to find modules

• You can search for modules (and http://search.cpan.org/ • CPAN: C omprehensive P erl A rchive • Central repository for Perl modules and more • “If it’s written in Perl, and it’s helpful and free, it’s probably on CPAN” • http://www.perl.com/CPAN/

Open a web browser Go to http://search.cpan.org/ Type in “bioperl” Follow the link to Bio::Tools::Blast Exercise 14 Read the example code Copy the example code to a file and try to run it.

Bioperl Overview

• The Bioperl project – • Comprehensive, well documented set of Perl modules • A bioinformatics toolkit for: • Format conversion • Report processing • Data manipulation • Sequence analyses • and more!

www.bioperl.org

• Written in object-oriented Perl

Bioperl Overview

• The last exercise most likely did not work (unless you have BioPerl installed) • So let’s install it…

How to install modules

• This class is using the active state version of Perl Package Manager) • At the command prompt type >ppm And follow the instructions in the exercise

How to install modules (without ppm) • If you are not using active state Perl, you you can also install modules from CPAN using: >perl –MCPAN –e “install ‘Some::Module’” • Module dependency is taken care of module successfully

Install bioperl 1. At the command line prompt type >ppm 2. Then at the ppm prompt type ppm> search bioperl Exercise 3. Then type ppm> install bioperl Try running the example code from the last exercise.

Enter the code on the next slide and run it.

15

Exercise

#bioperl example code use strict; use warnings; #make the bioperl module (class) accessible to your program use Bio::DB::RefSeq; #make a new instance (object) of the class and name it my $refseq = new Bio::DB::RefSeq; #call a method of the object to do something #in this case, another object is returned my $molecule = $refseq->get_Seq_by_acc('NM_006732');

16

#call a method or retrieve an attribute of the object #in this case, the sequence is returned print "seq is ", $molecule->seq, "\n";

What are objects?

• Examples of objects in real life: – My car, my dog, my dishwasher… • Objects have ATTRIBUTES and METHODS

Some attributes of a my dog Fido:

•Color of fur = brown •Height = 20 cm •Owner’s Name = Ian •Weight = 2 Kg •Tail position = up Fido

Some methods of my dog Fido:

•Bark •Walk •Run •Eat •Wag tail

What is a class?

• A class is a type of object in the real world: – Cars, dogs, dishwashers… • Classes have ATTRIBUTES and METHODS

Some attributes of a dog:

•Color of fur •Height •Owner’s Name •Weight •Tail position

Some methods of a dog:

•Bark •Walk •Run •Eat •Wag tail The concept of a “dog”

So an object is an instance of a class class

The concept of “dog”

object Fido

Objects have unique names called “references” and classes have names too.

class

Dog

object Class name Fido reference

All classes have a method called new is used to create objects.

that class

Dog

object Fido = new Dog(); reference Fido

A reference to an object can be used to access its properties or methods.

class

Dog

object woof print Fido->bark(); Fido

A reference to an object can be used to access its properties or methods.

class

Bio::DB: :RefSeq $refseq = new Bio::DB::RefSeq;

object

$molecule = $refseq->get_seq_by_acc(“NP_01014”);

$molecule = Some sequence record $refseq

Exercise 16

#bioperl example code use strict; use warnings; #make the bioperl module (class) accessible to your program use Bio::DB::RefSeq; #make a new instance (object) of the class and name it my $refseq = new Bio::DB::RefSeq; #call a method of the object to do something #in this case, another object is returned my $molecule = $refseq->get_Seq_by_acc('NM_006732'); #call a method or retrieve an attribute of the object #in this case, the sequence is returned print "seq is ", $molecule->seq, "\n";

Putting it all together

So now that you understand (sort of) Classes Objects Attributes and Methods What remains is learning what the different classes are that are available in BioPerl and what you can do with them.

For the next exercise, use the documentation at bioperl.org* to figure out what the following code does… *see www.bioperl.org/wiki/HOWTOs and doc.bioperl.org (then click on bioperl-live)

#!/usr/bin/perl –w

Exercise 17

use strict; use Bio::SeqIO; Make the Bio::SeqIO class available to my program my $seq_in = Bio::SeqIO->new( -file => “myGBrecord”, Create a new Bio::SeqIO object and initialize some attributes -format => “genbank”); my $seq_out = Bio::SeqIO->new( -file => “>myEMBLrec”, a sequence object -format => ‘EMBL’); my $seq_record = $seq_in->next_seq(); $seq_out->write_seq($seq_record);

More Bioperl modules

• Bio::SeqIO: to another • Bio::Seq: Sequence Input/Output – Retrieve sequence records and write to files – Converting sequence records from one format Manipulating sequences – Get subsequences ( $seq->subseq($start, $end) ) – Find the length of the object ( $seq->length ) – Reverse complement a DNA sequence – Translate a DNA sequence ….etc.

• Bio::Annotation: Annotate a sequence – Assign journal references to a sequence, etc.

– Bio::Annotation is associated with an entire sequence record and not just part of a sequence (see also Bio::SeqFeature)

Some more Bioperl modules

• Bio::SeqFeature: Associate feature annotation to a sequence – “features” describe specific locations in the sequence – E.g. 5’ UTR, 3’ UTR, CDS, SNP, etc – Using this object, you can add feature annotations to your sequences – When you parse a genbank file using Bioperl, the “features” of a record are stored as SeqFeature objects • Bio::DB::GenBank, GenPept, EMBL and Swissprot: Remote Database Access – You can retrieve a sequence from remote databases (through the Internet) using these objects

Even more Bioperl modules

• Bio::SearchIO: Parse sequence database search reports – Parse BLAST reports (make custom report) – Parse HMMer, FASTA, SIM4, WABA, etc.

– Custom reports can be output to various formats (HTML, Table, etc) • Bio::Tools::Run::StandAloneBLAST: Run Standalone BLAST through perl – By combining this and SearchIO, you can automate and customize BLAST search • Bio::Graphics: Draw biological entities (e.g. a gene, an exon, BLAST alignments, etc)

Bioperl Summary

• For Online documentation: – For this workshop: http://doc.bioperl.org/releases/bioperl-1.4/ – Tutorial: http://www.bioperl.org/wiki/HOWTO:Beginners – HOWTOs: http://www.bioperl.org/wiki/HOWTOs – Modules: http://www.bioperl.org/wiki/Category:Core_Modules • Literature: – Stajich et al., The Bioperl toolkit: Perl modules for the life sciences. Genome Res. 2002 Oct;12(10):1611-8.

PMID: 12368254 • Bioperl mailing list: [email protected]

– Best way to get help using Bioperl – Very active list (upwards of 10 messages a day) • Use with caution: things change fast and without warning (unless you are on the mailing list…)

Perl Documents

• In-line documentation – POD = plain old documents – Read POD by typing perldoc – E.g. perldoc perl, perldoc Bio::SeqIO • On-line documentation – http://www.cpan.org

– http://www.perl.com

– http:/www.bioperl.org

• Books – Learning Perl (the best way to learn Perl if you know a bit about programming already) – Beginning Perl for Bioinformatics (example based way to learn Perl for Bioinformatics) – Programming Perl (THE Perl reference book – not for the faint of heart)

Additional Book References • Perl Cookbook 2 nd edition (quick solutions to 80% • Learning Perl Objects, References & Modules (for people who want to learn objects, references and modules in Perl) • Perl in a Nutshell (an okay quick reference) • Perl CD Bookshelf, Version 4.0 (electronic version of the above books – best value, searchable, and kill fewer trees) • Mastering Perl for Bioinformatics (more example based learning) • CGI Programming with Perl (rather outdated treatment on the subject... Not really recommended) • Perl Graphics Programming (if you want to generate graphics using Perl; side note – Perl is probably not the best tool for generating

#!/usr/bin/perl use strict; use warnings; #TASK: demonstrate the use of “my” in setting the #scope of a variable my $some_variable = 100;

Answer 12

#body of the main program with the function call print "the value of some_variable is: $some_variable\n"; subroutine1(); print "but here, some_variable is still: $some_variable\n"; #subroutine using $some_variable sub subroutine1{ my $some_variable = 0; print "in subroutine1,some_variable is: $some_variable\n"; } #what happens if you comment out "use strict" and #remove "my" from lines 7 and 16

#!/usr/bin/perl use strict; use warnings; #TASK: check your answers to the regex excercise #open input and output files open(IN,"myanswers.txt"); #read the input file line-by-line #for each line test if it matches a regular expression while(){ chomp; my $is_correct = does_it_match($_); if ($is_correct){ print "$_ is a match\n"; } else{ print "$_ is NOT a match\n"; } } #close input file and exit close(IN); exit(); #does it match sub does_it_match{ my($answer) = @_; my $is_correct = 0; if ($answer =~ m/^ATG?C*[ATCG]+?A{3,10}$/){ $is_correct = 1; } return $is_correct; } Answer 13