Transcript Chapter 17.
From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein DNA gets all the glory, but proteins do all the work! AP Biology trait Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway A AP Biology enzyme 1 Am I just the sum of my proteins? disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations asexual spores Minimal medium spores Growth on complete medium positive control Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium Minimal media supplemented only with… experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control amino acid p-Amino Niacin Inositol acid Folic supplements acid Thiamine benzoic acid AP Biology a a From gene to protein nucleus cytoplasm a a DNA mRNA a a a a a a a a a a a protein a a a a a a a trait AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 RNA ribose sugar N-bases ____________________ ____________________ ____________________ ____________________ lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription Making mRNA transcribed DNA strand = ___________________ untranscribed DNA strand = ________________ synthesis of complementary RNA strand same sequence as RNA transcription bubble enzyme __________________________ 5 C DNA G 3 A G T A T C T A 53 G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA coding strand 5 RNA polymerase template strand RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 ______________________ AP Biology transcribes genes into mRNA RNA polymerase 3 only transcribes rRNA genes makes ribosomes only transcribes tRNA genes each has a specific promoter sequence it recognizes Which gene is read? ________________________ binding site before beginning of gene __________________________________ binding site for RNA polymerase & transcription factors ________________________ binding site far upstream of gene turns transcription on HIGH AP Biology Transcription Factors Initiation complex ___________________________________________ AP Biology suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Eukaryotic genes have junk! Eukaryotic genes are not continuous ___________ = the real gene expressed / coding DNA introns come out! ___________ = the junk inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription ______________________________ ______________________________ edit out introns ______________________________ intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 base spliced mRNA Discovery of exons/introns Richard Roberts CSHL Philip Sharp MIT beta-thalassemia AP Biology 1977 | 1993 adenovirus common cold Splicing must be accurate No room for mistakes! a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| Whoa! I think we just broke a biological “rule”! RNA splicing enzymes _________________ ________________ proteins snRNPs snRNA intron exon exon 5' _________________ several snRNPs recognize splice site sequence spliceosome 5' 3' cut & paste gene No, not smurfs! “snurps” AP Biology 3' mature mRNA lariat 5' exon 5' 3' exon 3' excised intron Alternative splicing _______________________________________ when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene! AP Biology More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________ ________________________________ 3' mRNA 5' AP Biology P G P P A a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Translation from nucleic acid language to amino acid language AP Biology 2007-2008 How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 AP Biology How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids AP Biology created artificial UUUUU… mRNA found that UUU coded for phenylalanine Marshall Nirenberg 1960 | 1968 Har Khorana AP Biology The code Code for ALL life! Code is redundant several codons for each amino acid 3rd base “wobble” _______________ strongest support for a common origin for all life AUG methionine _______________ AP Biology UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3 5 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3 UAC tRNA amino acid AP Biology Met codon 5 GCA Arg CAU Val anti-codon a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome aa trait AP Biology Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology Loading tRNA __________________________________________ enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure _____________________________ _________________ AP Biology _____________ _____________ E P A Ribosomes ____________ (aminoacyl-tRNA site) ____________ (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain Met ____________ (exit site) AP Biology empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Building a polypeptide Initiation Elongation brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination 3 2 1 end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C UGAA U mRNA A U G 3' E P A AP Biology 5' UAC GAC A U G C U GAA U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A 3' Destinations: Protein targeting ______________________ _____________________ start of a secretory pathway AP Biology secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Can you tell the story? AP Biology The Transcriptional unit enhancer exons 1000+b 20-30b 3' TAC transcriptional unit 5' DNA ACT introns 5' 3' 5' AP Biology 3' Bacterial chromosome Proteion Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes ________________ _ ________________ _ ________________ _ ________________ introns _ come out! ________________ intron = noncoding (inbetween) sequence _ eukaryotic ________________ DNA ________________ _exon = coding (expressed) sequence _ AP Biology ________________ _ ________________ _ ________________ _ ________________ _ Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes AP Biology takes eukaryote ~1 hour from DNA to protein RNA processing Any Questions?? What color would a smurf turn if he held his breath? AP Biology 2007-2008