Transcript Conservation Genetics - University of Georgia

Conservation
Genetics
6080 Fall 2009
We will talk about genetics from two
perspectives.
First, we will talk about how genetics
influences the viability of populations, both
now and in the sense of adaptation to future
change.
Second, we will talk about how genetic tools
provide new insight into conservation
problems and what new conservation policy
may arise.
What to count?
Nc= number of individuals
Or
Ne= genetically effective population
From a genetics perspective
Know WHAT to count..genetic effective population
size Ne
• Populations are smaller than they seem
• Genetic diversity is lost as Ne declines, not
just Nc
• Ne reduced by many things, e.g., unequal
sex ratio, mating structure, population
fragmentation, age-related disease (Ebola),
etc. etc.
Genetically effective
population
• The genetically effective population (N
with subscript e, Ne) is the number of
individuals in a population that
contribute genes to the next generation.
• It is usually less, and often much less,
than the census population (Nc).
• It is influenced by age structure, sex ratio,
social structure, and especially by spatial
structure. Metapopulation structure may
enhance population viability but it may also
contribute to loss of genetic variation by
reducing Ne. Genetic models typically use Ne
rather than Nc.
• Loss in heterozygosity depends on Ne not Nc
First, a conservation crisis
and a genetics enigma
All the remaining individuals
of the Great and Lesser
Apes would fit into a couple
of football stadiums
(IUCN Red Book 2007)
Ebola virus in Africa (made
worse by war, habitat loss
(logging and oil palm), bushmeat,
poaching, etc.) Ne =?????
The enigma of viruses
• Cause of many diseases that threaten
species (plants and animals).
• Total number of viral types is huge.
• Viruses, especially single strand RNA
viruses, have very high mutation rates.
• Viruses are obviously successful yet
many have as few as five genes. Ebola
has only 15 genes.
Viral enigma
• With high mutation rates and few genes
how do they adapt to host immune
defenses????
AND…effects of genetic change on ecosystems
A species’ pool of genetic diversity exists at
three fundamental levels
What can you learn about
populations from measuring
levels of heterozygosity?
First, you have to know what is
“normal” or average for the
taxon.
Among population genetic diversity
(Dpt) What can it tell you?
Above average for taxon: Unusual spatial segregation; low
mobility; high site fidelity (Red Cockaded Woodpeckers, Howler
monkeys); farther from “ideal” breeding population Nc much
Higher than Ne
Below average for taxon: Unusual high migration; panmixis;
closer to “ideal” breeding population Nc close to Ne
Heterozygosity
• Some genetically identical
populations do well (Northern
Elephant Seal) others not
(Cheetahs)
• Rate of decline in heterozygosity
is extremely important
What can genetics tell us?
Hairy-Nosed Wombat.
Is 65 enough to
survive?
If these populations can
increase, are these numbers
good insurance against
extinction? Must also
consider genetic variation.
300 Right Whales?
1000 Kemp’s Ridley Turtle?
Population bottlenecks and
reduced genetic variation
Genes lost
through drift
Slower recovery of
genetic variation
More homozygosity
…
..
Lost uncommon
black allele
Rare alleles more likely lost in
small populations
(genetic drift)
Galapagos tortoise population on Volcan alcedo
suffered severe bottleneck about time of massive
eruption (molecular clock and geological evidence).
Population has less genetic variation than other
populations but population has recovered.
American bison, a bottleneck enigma?
At time of European contact, bison estimate was
about 60,000,000
By 1890 it was about 750
By 2000 the number was about 360,000
Bison have considerable genetic variation
(within and between population heterozygosity).
How did they retain so much genetic
variation???
Hint: geographic herds and buffalo parks.
Some, but not all, inbred
populations have lower fitness
due to expression of
deleterious genes
Deleterious genes are usually
recessive. So in more
homozygous inbred
populations they are more
likely to occur at the same
locus.
Inbred white-footed mice
(open circles) had lower
survivorship than outbred
individuals (solid circles)
after release into the wild
Inbreeding depression
Vulnerable small populations
Population of 40 European Adders was isolated by road. In
a few years malformed individuals and lower birth rates
began to cause population decline. This is an example of
inbreeding depression. Population growth was restored
when individuals from different population were introduced.
Not all alleles are equal
• MHC (major histocompatibility complex)
genes enhance immune response.
Located on chromosome 6 in humans.
• Heterozygous MHC generates more
types of immune molecules and
therefore is more “adaptive” to counter
diverse pathogens.
Intracellular diversity of MHC
is important
• MHC codes for large proteins that
transport viral particles to surface and
holds them for T-cells (killer cells)
• Viral diversity is best delt with by
diversity of MHC proteins
• Trade-off is that large proteins are costly
to make. Therefore…..?
African Cheetahs, wild and in zoos, are highly inbred
with little genetic variation. A feline viral disease swept
through European zoos killing many cheetahs. Lions
have much greater genetic variation and were relatively
unaffected by the disease.
Many domesticated plants and animals,
especially pets, are highly inbred
…and some people. Why states outlaw marriage between
close relatives.
Charles II of Spain illustrates the Hapsburg lip, an
Inbred trait in this royal line.
Severe effects of inbreeding in zoo tiger
Bottleneck consequences
• More deleterious genes expressed by more
homozygosity means very slow recovery or
extinction
(African Cheetah)
• Fewer deleterious genes means fast recovery
(N. Elephant Seal)
• Recovery from bottleneck may reduce future
inbreeding effects.
• Founder effect from migrants from small
population
Genetics as a tool for
conservation
management
Genetics provides new insight
• Pacific Gray Whales thought to be
recovery success at 22,000 current Nc
• But, 10% whales are undernourished
• Calving frequency is down
• Feeding behavior has shifted from
“bottom plowing” (which supports sea
birds) to feeding in water column
Pacific Gray Whale: Using Genetics to Infer the Past
Gray whales migrate from winter feeding area to southern
mating and breeding site. Longest mammal migration.
Pit marks left by whale foraging. Currently resuspend about 172 million tons each year. More
than 2X that produced by the Yukon River, the
3rd largest US river. Nutrients support fish and
food for sea birds.
Recovery to 22,000. A success story?
Gray whale con’t
• Genetic variation between individuals
indicates much larger population in past
(mismatch analysis of sequence
frequencies)
• Accounts from 1700s indicates large
whale populations. Their “fetid breath
fouled Monterey Bay..” Calif. Bishop
Gray whale con’t
• Decline in plankton, plankton-feeding fish and
the birds that eat those fish suggests a
decline in productivity
• Probably related to global warming and
temperature increase in coastal waters
• Thus, Gray Whales may not be at historic
carrying capacity but rather the environment
is changing to their detriment.
Gray whale con’t
• Genetic information suggests an early
population between 78,500-117,000
• These populations would have
disturbed between 22-31% of the sea
sediment each year
• …and the effect from this nutrient input
on birds and fish??
Grizzly bears: what genetic
tools can tell us
• The size of the population
• The sex ratio
• Migration
Done through the use of microsatellite
markers.
Note: DNA alphabet has only four “letters” A,C,T,G
and these can only pair AT, CG
Microsatellite is a repetitive sequence of 1-6 base pairs
on single strand of DNA
Individual one: Two microsatellites.
7AC and 3ACT
ACTAGACACACACACACACTAGCGACCTACTACTACTAG
Individual two: Two microsatellites.
6AC and 3ACT
ACTAGACACACACACACTAGCGACCTACTACTACTAG
In practice, many microsatellites are needed to create individual
genetic fingerprints, i.e. to identify individuals. But fewer
needed to identify species or geographic populations.
Grizzly bear range in lower 48 states
Genetic markers to determine
origins of protected
populations
• DNA amplified from fecal and tissue
samples
• Used to construct DNA library to
determine origin of elephant ivory, etc.
Genetics and captive breeding.
May select for individuals that are adapted to the captive
environment but not to the wild environment, e.g., may not
recognize predators. Difficult to avoid.
Wildlife as possible vectors of antibiotic resistance genes?
Canada geese in Chesapeake Bay carried E. coli resistant to
penicillin G, ampicillin, cephalothin, and sulfathiazole; and
enterococci resistant to cephalothin, streptomycin, and
sulfathiazole.
Better insight into conservation
problems by combining genetic
with non-genetic tools
Swainson Thrush..A
neotropical migrant.
Declining in some
parts of its U.S.
breeding range but not
in others. Why?
Swainson Thrush breeds in northern
North America from northern California
and Great Lakes into Canada and Alaska.
During the non-breeding season it is
somewhere in the southern US or down
into Latin America as far as Argentina.
Combining genetic with other methods
For migratory birds, how can we
associate breeding sites with
non-breeding sites? For Swainson
thrush breeding in Wisconsin, where
did they spend their
non-breeding time?
Suppose the Wisconsin population began
declining and you want to know what is
happening to the thrush’s habitat on its
non-breeding habitat. Where would you
begin to look?
If you banded 100 birds in Wisconsin, what
would be the probability of recovering them
somewhere between Georgia
and Argentina???
Genetics
Mitochondrial DNA (mtDNA) is extranuclear
and therefore inherited maternally.
Chloroplast DNA in plants is similar.
mtDNA is not reorganized during
recombination and remains stable within
maternal lines, except for mutations.
mtDNA is haploid. Segments of DNA can be separated
by restriction enzymes and sequenced for their gene
array.
Segments (microsatellites) that are associated with
specific geographic areas are called haplotypes. For
the thrush, there are tropical coastal haplotypes and
interior haplotypes.
Very small amounts of blood can be taken from
feathers and the DNA amplified by PCA for analysis by
sequencing.
…coupled with non-genetic method
Stable isotopes: Non-radioactive elements
with more than the normal number of
neutrons. Most stable isotopes have one or
two extra neutrons and are therefore very
slightly heavier, e.g., Carbon-12/13,
Nitrogen-14/15, Oxygen-16/18,
Deuterium -1/2, and Sulfur-32/34
Hydrogen H/D: strong North-South gradient in
ratio in precipitation
Sulfur: marine sulfur is enriched with heavy
sulfur isotope
Therefore: H/D isotopes in feathers record the
latitude of molt
S/S isotopes in feathers tell if individual was
from a coastal population
Pre-molting feathers were sampled for isotope
ratios and mtDNA to provide evidence of where
the female was when the feathers were formed
the previous year. Non-invasive.
Birds were banded.
Results
By combining both isotope and mtDNA
analysis, 75% of the birds could be assigned
to their correct breeding and non-breeding sites.
Reference: Kelly et al. 2005. Combining isotopic and
genetic markers to identify breeding origins of migrant
birds. Ecol. Appl. 15: 1487-1494.
POLICY IMPLICATIONS ???
Genes and Ecosystems
Cottonwood trees
(Populus spp.)
Occurs along streams
Several species hybridize
Cottonwood
+ beavers
=
Cottonwood
genotypes =
with high
tannin conc
Fewer insects and
less endophytic
fungi
and
Fewer birds