Transcript Document
Human Identity Testing Purpose: Match a person to a DNA sample. Examples: • Paternity Test • Genetic History • Historical (Thomas Jefferson, Sally Hemings) • Genealogical • Forensic • Missing Persons • Identifying body parts Forensic DNA Source: Any biological material containing cells Examples: • Blood • Hair (must have root) • Bone / teeth • Saliva • Urine • Semen • Vaginal secretions • Futuristic: discarded epidermal cells CODIS (Combined DNA Index System) Purpose: Allow participating laboratories to exchange and compare profiles at a national level in electronic form. Factoids: • 1990: pilot launched by FBI • 1994: DNA Identification Act passed (authorized FBI to implement a national forensic data base) • 1998: became operational • 2000: added missing persons CODIS: 13 STR Loci and AMEL TPOX D3S1358 D8S1179 D5S818 FGA CSF1PO TH01 VWA D7S820 AMEL D13S317 D16S539 D18S51 D21S11 AMEL STR (Short Tandem Repeat) TH01: TCAT repeat in the first intron of the tyrosine hydroxylase gene TCATTCATTCATTCATTCATTCAT 1 2 3 4 5 6 TCATTCATTCATTCATTCATTCATTCAT 1 2 3 4 5 6 7 TCATTCATTCATTCATTCATTCATTCATTCAT 1 2 3 4 5 6 7 8 STR Allele Frequencies 45 40 TH01 Marker Frequency 35 30 Caucasians (N=427) Blacks (N=414) Hispanics (N=414) 25 20 15 10 *Proc. Int. Sym. Hum. ID 5 (Promega) 1997, p. 34 0 6 7 8 9 9.3 Number of repeats 10 Genotyping at the TH01 Locus: Moe: 7/9 1 2 0 1 2 4 1 2 8 1 3 2 L engt h 1 3 6 1 4 0 1 4 4 1 3 6 1 4 0 1 4 4 1 3 6 1 4 0 1 4 4 (bp) Larry: 9.3/9.3 1 2 0 1 2 4 1 2 8 1 3 2 L e ngt h (bp) Curly: 6/9 1 2 0 1 2 4 1 2 8 1 3 2 L engt h (bp) Reference 10 6 120 124 7 128 8 132 Lengt h (bp) 9 136 9.3 140 144 Moe: 7/9 1 2 0 1 2 4 1 2 8 1 3 2 L engt h 1 3 6 1 4 0 1 4 4 1 3 6 1 4 0 1 4 4 1 3 6 1 4 0 1 4 4 136 140 144 (bp) Larry: 9.3/9.3 1 2 0 1 2 4 1 2 8 1 3 2 L e ngt h (bp) Curly: 6/9 1 2 0 1 2 4 1 2 8 1 3 2 L engt h (bp) Crime Scene DNA 120 124 128 132 Lengt h (bp) AMEL (amelogenin locus) • quick, inexpensive sex determination • AMEL gene on X chromosome has 6 fewer base pairs than the gene on the Y chromosome • XX give one “short” peak • XY give two peaks, one “short” and one “long” Human Identity Testing with Multiplex STRs AmpFlSTR® SGM Plus™ kit amelogenin D19 D3 D8 TH01 VWA D21 D16 D18 D2 FGA first person amelogenin D3 D19 second person D8 VWA TH01 D16 D21 FGA D18 Simultaneous Analysis of 10 STRs and Gender ID D2