Transcript Document
FilmArray: Automated PCR Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge gained from Biology? PCR: A Quick Review Polymerase Chain reaction: Quiz: what do you know? Components of PCR G C C T G A A Free nucleotides C C C A G T Taq polymerase T Primer 5’ 3’ TCCACAGGCGCTATCTGCT AT C G AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ Template DNA Buffers 5’ PCR Process -Heat denatures template strand -Forward and reverse primers are annealed to single stranded DNA -Taq polymerizes dNTP’s to elongate the replicated strand. PCR Amplification Original DNA Copy 5 cycles of PCR amplify 1 copy into 32………and so on Instruments for Viewing PCR Results •Gel Electrophoresis and Camera image of agarose gel PCR in the Classroom How long does PCR take? Improving the Process: PCR today New Concepts Biotechnology industry utilizes many new improvements in conducting and analyzing the PCR process Fluorescent DNA: DNA Binding Molecules = + GCAATCGTGTCATGTCTG CGTTAGCACAGTACAGAC GCAATCGTGTCATGTCTG CGTTAGCACAGTACAGAC Fluorescent molecules that bind to double stranded DNA help make it visible. Works like ethidium bromide in gel electrophoresis Camera Records a Fluorescent Image Every Cycle Visible Realm Greater Than 10 Billion Copies Number of DNA Copies PCR Cycle 1 5 10 15 20 25 30 40 Real-Time PCR Uses a camera and Software to plot fluorescence during PCR Nested PCR Nested reaction includes: 1. outer PCR (PCR1) 2. dilution 3. inner PCR (PCR2) *allows for more specific amplification of selected organisms Nested RT-PCR Primer Designs Virus Genome Outer RT-PCR 200bp Inner PCR 90bp Multiplex Assays Uses multiple primers in one reaction to amplify several different DNA templates present in a sample i.e.: clinical sample run on a panel of 20 organisms to determine presence of infection Schematic of Nested Multiplex PCR Primary RT-PCR 1F Secondary PCR 1R 2F 2R 3F 3R 4F 4R 5F 5R 6F 6R Dilute 100 fold Primer Design Primer of 17 base pairs has 1 in 10 billion chance of laying down on human genome. Design never goes below 17 bp (usually 18-20bp) 3’ 5’ AGGCGCTATCTGCT ATC AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ 5 Our Project: FilmArray Collaboration Chemists: PCR reactions occurring in the pouch Engineers: Pouch development and Instrument development Software: Communication from instrument to computer, analysis of data Film Array instrument allows for automated PCR with results in approximately 1 hour FilmArray Pouch Cell Lysis PCR1 Mag Bead Capture PCR2 Pouch substitutes pipettes and tubes for mixing substitutes chemist on a bench-top FLASH ANIMATION FilmArray Beta Prototype Substitutes mechanical actions of chemist and benchtop instruments (bead whacker=vortex, mag. beads and blisters=filter tubes and centrifuge, peltier=thermo block, array=DNA detection Run Protocol 1st PCR DNA Melt 2nd PCR There are two Peltier Thermocyclers The software displays the temperature during each PCR and the melt Green indicates camera acquisitions: Once per PCR2 cycle 2500 in the 5 min melt Example of Results PCR1 Control PCR2 Control Sc DNA assay Sc RNA assay Sp DNA Assay Sp RNA Assay 2nd PCR Post PCR Melt Software makes call, positive or negative result Film Array Utilizes Faster Process Sample utilization: 120 1uL reactions = 1/10 price Pre amplification (PCR 1= enrichment) amplifies enough to cover entire array every well Some micro-array processes have difficulty having enough sample for every well Risks of PCR Contamination is a HUGE risk factor Nesting not to popular because of how easily you can contaminate your assays False positives look the same as true positives The pouch is an all enclosed environment that eliminates the risk of contamination Reagent Lyophilization All reagents in the pouch or lyophilized (freeze dried) so all that is needed is water Freeze Dried reagents can have a shelf life of approximately 1 year Wet Bench Top reagents have short shelf life Proteins are protected with “cake” so they don’t die Film Array Applications: Projects Under Development Respiratory Panel: Clinical Samples Febrile Infant Risk Stratification Tool (FIRST): bacterial identification for infant fever Biothreat Pouch:Department of Defense Methicillin Resistant Staph. aureus detection:characterizing outbreaks of Staph infection in the hospital and community Tuberculosis Screening Respiratory Panel Resp. Panel screens samples for 16 viruses or bacteria in 1 hour PIV1 PIV2 PIV3 PIV4 FluB RSV FluA Adenovirus Enterovirus Coronavirus HN FG FG FG HA MG MA HA HA HA NA NA Hex 3' UTR Pol NG Pol NG Pol NG Pol NG NG PL hMPV NG Pol Bocavirus NP-1 NS-1 B. pertutsis Toxin M. pneumoniae gyrB M. pneumoniae Toxin C. pneumoniae gyrB Out control AtD08 Dilution cont AtR04 PCR2 Control AtR04 RNA Process SpR05 DNA Process SpD02 Pan H3 H5 H5 N1 N2 HRV 229E 229E OC43 OC43 HKU1 HKU1 NL63 NL63 SARS SARS Micro-array: Automated Pipetting Spots Primers in specific layout Film Array a b c d e f g h I j k l 1 2 3 4 5 6 7 8 9 10 AtR04 rpoB1Spne FluAN1NA05 RSVMG0 FluBHA01 AtD02 FluAH3Ha04 AdHex-iF1R1 ScD05 AtD08 AdHex-iF2R1 PIV1HN01 PIV3FG01 FluBHA01 AdHex-iF1R2 gyrB3Mpne ScD05 AdHex-iF2R2 rpoB1Spyo FluANaN206 RSVMG0 gyrB3Mpne PIV1HN01 FluAHA1 AdHex-iF2R1 PIV2FG02 CoVOC43NG07 FluAHA1 AdHex-iF1R1 ScR03 AtD08 PIV2FG02 AtD08 AtD02 AdHex-iF2R2 AtD08 FluAH3Ha04 rpoB1Spne PIV1HN01 FluANaN206 ScD05 FluAN1NA05 rpoB1Spne CoV229EPL01 PIV3FG01 AdHex-iF1R1 FluAH3Ha04 RSVMG0 FluBHA01 ScR03 FluAHA1 CoV229EPL01 AdHex-iF2R1 PIV2FG02 AtR04 CoV229EPL01 ScD05 rpoB1Spne AdHex-iF2R2 AdHex-iF1R2 ScR03 PIV3FG01 ScR03 AtR04 rpoB1Spyo gyrB3Mpne PIV3FG01 rpoB1Spyo PIV2FG02 RSVMG0 FluAN1NA05 FluANaN206 AtR04 AdHex-iF2R2CoVOC43NG07 PIV1HN01 CoVOC43NG07 FluAN1NA05 gyrB3Mpne CoV229EPL01 AdHex-iF1R2 rpoB1Spyo AtD02 AdHex-iF1R2 FluAHA1 AdHex-iF1R1 FluANaN206 AdHex-iF2R1 CoVOC43NG07 FluAH3Ha04 FluBHA01 AtD02 Kody (BioChemistry Intern) Pouch Production Freeze Dry Reagents Reagent QC Primer Validation and Tracking Assay Optimization Pouch/Protocol Optimization Build and Update Database Meghan (Research Associate I) NanoPlotter validation and QC Film Array instrument optimization Assist with pouch production Idaho Technology Broad range of projects Great experience, resume builder Offers career opportunities, internships, and benefits Join the ITI Team Visit:http://www.idahotech.com/work_with_us/ Questions?