Transcript Document
ESID Prague meeting, 14-15 May 2007 V(D)J recombination and its defects Mirjam van der Burg, PhD Dept. of Immunology Erasmus MC, Rotterdam NL [email protected] Outline - V(D)J recombination and its key players - V(D)J recombination defects in SCID - Case report of SCT of Artemis-deficient SCID patient V(D)J recombination of the IGH gene VH 1 2 3 DH 4 5 6 70 1 2 3 C JH 4 5 27 1 2 3 4 5 6 s DH to JH rearrangement BREC + signal joint VH to DH-JH rearrangement V IgH D IgH J V C V C J J C C C C transcription IgL precursor IGH mRNA translation C C signal joint C CD79b C BREC J RNA splicing CD79a IgL + V D mature IGH mRNA VDJ C V(D)J recombination of the TCRB gene V2 V 3 V4 V5 Vn D1 J1 1 2 3 4 5 6 D2 J2 1 2 3 4 5 6 7 C2 J rearrangement 1 J 2 D C1 + V D-J rearrangement D-J signal joint coding joints V4 Vn + e g io 1 r V n J n D2 J2.3 C C2 CD3 CD3 transcription V-D signal joint CD3 translation CD3 CD3 V V 1 V IgH D V IgH J D J V V C J J C C IgL TCR TCR TCR TCR C C V V V V C C C CD79a D C CD79b IgL C J J J J C C C C CD3 CD3 CD3 B-lymphocyte D CD3 CD3 T-lymphocyte CD3 CD3 CD3 CD3 CD3 T-lymphocyte Identification and isolation of B-cell subsets UCB bone marrow tonsil mature-B SmIg+ CD34+ lin– pro-B pre-B-II large pre-B-I pre-B-II small immature B mature-B SmIg+ CD3/13/19/33/56 CD22 CD34+ CD34+ lin– CD22+ (defined as: CD19– CD3/13/19/33/56–) CD10 CD34+ CD19+ CD10+ CD20– M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. SmIgM CD34– CD19+ CD10+ CD20dim SmIgM– CD19+ SmIg CD19+ CD20 CD19+ CD20 CD19+ CD20 CD19+ CD34 CD34+ CD19 CD34 CD34+ CD10 CD10 CD34– CD19+ CD10+ CD20– CD34– CD19+ CD10+ CD20hi SmIg CD19+ CD20+ SmIg+ or SmIg+ M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. IGH gene rearrangements quantified in the B-cell subsets IGH gene complex (14q32.3) DH (n=27) VH(n=66) 100 mature-B SmIg+ mature-B SmIg+ immature-B mature-B SmIg+ mature-B SmIg+ immature-B pre-B-II small pre-B-II large pre-B-I 0 pro-B 0 20 pre-B-II small 20 40 pre-B-II large 40 60 pre-B-I 60 80 pro-B 80 VH1-3 - JH1-6 VH4-7 - JH1-6 CD34+lin– % rearrangement DH1-3 - JH1-6 DH4-6 - JH1-6 CD34+lin– % rearrangement 100 C JH (n=6) M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. Summary of the Ig gene rearrangement processes during precursor-B-cell differentiation UCB bone marrow tonsil mature-B SmIg+ CD34+lin– pro-B pre-B-II large pre-B-I pre-B-II small immature B mature-B SmIg+ V-J/ V-J in-frame selection VH-DJH in-frame selection VH-DJH rearrangement DH-JH Kde (V-Kde and intronRSS-Kde) V-Jrearrangement V-J rearrangement M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. Gene expression profiling of human CD34+lin– and precursor B-cell subsets M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. Human B-cell Differentiation CD34+lin0.00002 0.00006 0.04089 0.092622082 23.07808182 0.01876 0.04368 1.35427 0.25437 10.03955 0.063379777 0.00009 0.02001 0.00009 0.03633 0.00002 12.10473843 0.000105359 pro-B 0.00202 0.00711 0.11344 0.13030822 47.83518 0.015356572 0.08391 5.02805 0.20236 2.918040688 0.13444 0.00031 0.05201 0.06079 0.01448 0.00000 4.773342972 0.00000 pre-B-I 0.01697 0.07780 0.28833 0.453499626 47.5147287 0.048431385 0.23439 4.82170 0.45701 2.26701 0.114753471 0.0082949 0.14621 0.11724 0.01080 0.00076 30.75526518 0.000380084 pre-B-II large pre-B-II small immature-B 0.00035 0.00428 0.00008 0.00921 0.02293 0.00660 0.53109 2.92265 1.25044 0.038315034 0.470261674 0.25391551 5.928416429 47.47544902 25.65041 0.02415 0.082380689 0.06453 0.00340 0.01599 0.00245 1.27956 2.86239 1.53144 0.01331 0.13964 0.05047 0.90049 15.83723 6.95773 0.431415906 0.378804284 0.38748 0.10968 0.465429126 0.09816 0.02633 0.09111 0.12343 0.34472 0.38599 0.10790 0.07988 0.26918 0.23847 0.00037 0.00628 0.00048 6.50682726 25.73920565 24.89000 0.000971692 0.002059927 0.00129 Gene RAG1 RAG2 KLF2 KLF4 COPEB KLF12 ERG ETS2 ELK3 ELF1 ETS1 SPIB OCT1 OCAB OCT2 POU4F1 SMARCA5 HIVEP3 EBF, LIG4 and RAG1 gene expression in human CD34+lin– and precursor B-cell subsets 3 2 EBF 12 LIG4 RAG1 1 0 -1 n=408 CD34+lin– pro-B pre-B-I pre-B-II large pre-B-II small immature-B -2 M.C. van Zelm, et al. J Immunol. 2005; 175: 5912-5922. V(D)J recombination in detail V V J RAG1/RAG2 complex binds to RSS DNA cleavage 1 hairpin coding ends blunt signal ends DNA-PKcs, Ku70/Ku80 and Artemis hairpin cleavage 2 opened hairpins TdT activity ligation by DNA ligase IV, XRCC4 and XLF signal joint coding joint Cell 2006;124:260-262. V(D)J recombination - Initiation by RAG1 and RAG2 is lymphoid specific - Hairpinopening, endprocessing and ligation by non homologous end joining (NHEJ) pathway for DNA ds break repair (Ku70, Ku80, DNA-PKcs, LIG4, XRCC4, XLF-Cernunnos) Outline - V(D)J recombination and its key players - V(D)J recombination defects in SCID - Case report of SCT of Artemis-deficient SCID patient Severe combined immunodeficiency (SCID) - Clinical symptoms: opportunistic infections, protracted diarrhea, failure to thrive, presenting in the first months of life - Many causative genetic defects have been described - Immunological classification helpful to search for genetic defect T-B-NK+ SCID is caused by defect in V(D)J recombination T-B-NK+ T-B-NK+ T-B+NKT-B-NKT-B+NK+ T–B–NK+ SCID - Approximately 20% to 30% of all SCID patients - One third of these patients have mutations in the recombination activating genes (RAG1 or RAG2) - RAG proteins are essential for induction of V(D)J recombination of Ig and TCR genes Flowcytometric analysis of precursor B-cell compartment in bone marrow BM Pro-B 1 2 PB Pre-B-I Pre-B-II 3 4 5 TdT TdT yL TdT yL 6 7 yL Ig large CD22 CD34 Immature B 8 Mature B 9 Ig small PreBCR+ PreBCR- smIgM SmIgM/IgD CD22 CD22 CD22 CD22 CD22 CD22 CD22 CD22 CyCD79a CyCD79a CyCD79a CyCD79a CyCD79a CyCD79a CyCD79a CyCD79a CD19 CD19 CD19 CD19 CD19 CD19 CD34 CD34 CD10 CD10 CD10 CD10 CD10 CD20 CD20 CD34 CD34 CD20 Composition of precursor B cell compartment in healthy children average <5y lthy children (n=6) RAG-SCID average(n=7) 5-10y temis-SCID (n=4) average 10-18y RS-SCID-B 0%0% 10% 20% 20%30% pro-B 40% 40% 50% pre-B-I 60% 60% 70% pre-B-II 80% 100% 80% 90% 100% immature B CyIg/SmIgM/CD19 on bone marrow of RAG- SCID SmIgM/CyIg/CD19 on bone marrow of RAG- SCID Precursor B-cell Composition compartment in RAG deficient SCID patients of bone marrow precursor B-cell compartment (corrected for blood contamination) Average <5y (n=9) RAG-SCID11 althy children (n=6) RAG-SCID9 RAG-SCID RAG-SCID6-0y7m(n=7) RAG-SCID4-0y2m rtemis-SCID (n=4) RAG-SCID3-0y4m RAG-SCID2.2-0y1m RS-SCID-B RAG-SCID2.1-0y8m 0% 0%10% 10% 20% 20% Pro-B cell (stage 1) CD22+/CD79-/CD36Pre-B-I cell (stage 5) CD19+/CyIgM-/CD10+ 30% 30% 40% 40% Pro-B cell (stage 2) CD79+/TdT- pro-B pre-B-I Pre-B-II cell (stage 6) CD19+/CyIgM+/VpreB+ 50% 50% 60% 60% 70% 70% Pro-B cell (stage 3) CD79+/TdT+ pre-B-II 80%80% 90% 90% 100% 100% Pre-B-I cell (stage 4) CD19+/CyIgM-/CD10++ Immature B B cell (stage 8) CD19+/SmIgM+ immature Pre-B-II cell (stage 7) CD19+/CyIgM+/VpreB- T–B–NK+ SCID patients without RAG gene mutations - A number of these patients are sensitive to ionizing radiation - Causative defect in DNA double strand break (dsb) repair via non-homologous end joining (NHEJ) V(D)J recombination in detail V V J RAG1/RAG2 complex binds to RSS DNA cleavage 1 hairpin coding ends blunt signal ends DNA-PKcs, Ku70/Ku80 and Artemis hairpin cleavage 2 opened hairpins TdT activity ligation by DNA ligase IV, XRCC4 and XLF signal joint coding joint Clonogenic survival assay of fibroblasts after ionizing radiation (Artemis 1,2,3) 100 FN1 (wild type) % survival 10 NBS-1LBI Artemis-1 1 Artemis-2 Artemis-3.1 0.1 0.01 0 Artemis-3.2 1 2 3 4 5 Dose of X-rays (Gy) 6 Principle of the V(D)J recombination assay - Transfection of V(D)J recombination substrate into fibroblasts together with RAG1/RAG2 - Wild type fibroblasts - Artemis-deficient fibroblasts - Artemis-deficient fibroblasts with wt Artemis or Artemis mutant Signal and coding joint formation in Artemis– patients signal joint assay coding joint assay pGG49 pGG51 NV09F NV08F NV09F NV08F FM30 DG147 FM30 DG147 cotransfection of RAG1, RAG2 and constructs with (+) or without (-) Artemis cj sj -Art cj sj +Art -Art cj sj +Art -Art +Art signal joints coding joints FN1 control Artemis-1 (deletion exon 10-12) Artemis-2 (exon 5 G47T) Signal and coding joint formation in Artemis– patients signal joint assay coding joint assay pGG49 pGG51 NV09F NV08F NV09F NV08F FM30 DG147 FM30 DG147 cotransfection of RAG1, RAG2 and constructs with (+) or without (-) Artemis cj sj -Art cj sj +Art -Art cj sj +Art -Art +Art signal joints coding joints FN1 control Artemis-1 (deletion exon 10-12) Artemis-2 (exon 5 G47T) Composition of the precursor B-cell compartment in different types of T-B-NK+ SCID healthy children (n=6) RAG-SCID (n=7) Artemis-SCID (n=4) 0% DNA Ligase IV SCID 10% 20% pro-B 30% 40% pre-B-I 50% 60% pre-B-II 70% 80% 90% immature B 100% Composition of DH-JH junctional region in B–/T– SCID patients DH DH3-3 (germline) GTATTACGATTTTTGGAGTGGTTATTATACC insertion JH JH4-1 (germline) ACTACTTTGACTACT GTATTACGATTTTTGGAGTGGTTATTATA TGACTACT GTCCA GTATTACGATTTTTGGAGTGGTTATTATAC CTTTGACTACT CGATCG GTATTACGATTTTTGGAGTGGTTATTATACC ACTACTTTGACTACT GGT GTATTACGATTTTTGGAGTGGTTAT TTTGACTACT CGTAGCGTA GTATTACGATTTTTGGAGTGGTTATTATA ACTTTGACTACT CGTAG GTATTACGATTTTTGGAGTGGTTATTAT TGACTACT GGCTAAGG GTATTACGATTTTTGGAGTGGTTATTATACC TACTTTGACTACT CGGAGC GTATTACGATTTTTGGAGTGGT ACTACTTTGACTACT GGTTC GTATTACGATTTTTGGAGTGGTTATTATA CTTTGACTACT CGATCGA GTATTACGATTTTTGGAGTGGTTATTATA ACTTTGACTACT CC 1. Assignment of D and J gene segments usage 2. Frequency of palindromic (P) nucleotides (caused by asymetric “hairpin” opening) 3. Number of deleted nucleotides 4. Random insertion of nucleotides Composition of junction regions DH 3’ deletions P N P JH 5’ deletion Total number of deletions Healthy controls 3.1 0.2 5.7 0.3 6.3 9.4 RAG-SCID 4.0 0.2 7.7 0.1 8.1 12.1 Composition of DH-JH coding joints DH 3’ del P N P JH 5’ del Total P Total del Healthy controls (15) -4.2 0.1 7.9 0.1 -6.0 0.2 10.2 RAG-SCID (15) -4.0 0.2 7.7 0.1 -8.1 0.2 12.1 Artemis-SCID (53) -1.9 3.0 4.0 3.8 -1.1 6.7 3.3 Case report of T-B-NK+ SCID - Girl form consanguineous parents - In first year of life no problems - In second year development of infections of respiratory tracts and candidiasis - Successively, development of chronic diarrhea and failure thrive. - At 18 months suspicion for immunodeficiency due to hypogammaglobulinemia - Improvement with immunoglobulin substitution and broad-spectrum antibiotics. - BMT was initiated, but patient died during conditioning period Low numbers of T and B cells found in peripheral blood Patient Mean Mean Control RAG-SCID Artemis-SCID (x109/l) B cells 0.01 0.001 0.001 0.2-1.6 T cells 0.23 0.2 0.5 0.7-4.2 NK cells 0.5 1.1 1.1 0.09-0.9 Clonogenic survival assay of fibroblasts after ionizing radiation 100 % Survival 10 FN1 (wild type) Artemis 1 Patient SC2 0.1 0.01 0 1 2 3 4 Dose of X-rays (Gy) 5 6 Composition of the precursor B-cell compartment in different types of T-B-NK+ SCID healthy children (n=6) RAG-SCID (n=7) Artemis-SCID (n=4) Patient SC2 0% 10% 20% pro-B 30% 40% pre-B-I 50% 60% pre-B-II 70% 80% 90% immature B 100% Composition of coding joints of patient SC2 Van der Burg et al J. Clin. Invest 2006;116:137 Composition of DH-JH coding joints DH 3’ del P N P JH 5’ del Total P Total del Healthy controls (15) -4.2 0.1 7.9 0.1 -6.0 0.2 10.2 RAG-SCID (15) -4.0 0.2 7.7 0.1 -8.1 0.2 12.1 Artemis-SCID (53) -1.9 3.0 4.0 3.8 -1.1 6.7 3.3 SC2 -12.2 0.2 2.8 -16.0 0.1 28.2 0 RS-SCID caused by a deletion of three nucleotides in DNA ligase IV - First patient with RS-SCID due to DNA Ligase IV mutation -Different from described Ligase IV syndrome patients, because no microcephaly, growth delay (O'Driscoll M, et al, Mol Cell 2001) Van der Burg et al J. Clin. Invest 2006;116:137 - A Ligase IV mutation can give rise to RS-SCID - Clinical spectrum of Ligase IV mutations is broadened Immunodeficiency Microcephaly and growth delay Radiosensitivity RS-SCID ++ - + LIG4 syndrome + ++ + Leukemia - - + - Can other NHEJ defects be expected? Yes Cernunnos Conclusions - V(D)J recombination defects result in absence of T and B cells (SCID or growth retardation, microcephaly, and immunodeficiency) - Characteristic block in precursor-B cell differentiation - V(D)J defects can be caused by mutations in RAG1 or RAG2 - If not, fibroblasts are tested for radiosensitivity if RS, than a defect is expected in one of the components of NHEJ - Analysis of DH-JH coding joints gives insight in which step of V(D)J recombination is defective (Artemis-deficiency: long P – LIG4-deficiency: large deletions) - Fibroblasts can also be used for in vitro V(D)J recombination studies or complementation The Erasmus MC PID team Acknowlegdements Dept. of Cell biology and Genetics, Erasmus MC Nicole S. Verkaik Dik C. van Gent Dept. of Toxicogenetics, LUMC, Leiden Wouter Wiegant Albert Pastink Dept. of Pediatrics, Hacettepe University, Ankara, Turkey Tuba Turul Ilhan Tezcan Dept. of Immunology, The Children’s Memorial Health Institute, Warsaw Poland Beata Wolska Malgorzata Pac Ewa Bernatowska This work was supported by a grant from the Dutch Cancer Society (KWF, grant EMCR2002-2734) and ZonMw (Veni Grant 916.56.107) Outline - V(D)J recombination and its key players - V(D)J recombination defects in SCID - Case report of SCT of Artemis-deficient SCID patient Differences in outcome of SCT of B-negative SCID and B-positive SCID - HLA non-identical T-cell depleted SCT are significantly better for B-positive SCID than for B-negative SCID (J.Pediatr 1999;134:740-8) - Reduced survival of B-negative SCID associated with: - diminished rate in engraftment - higher frequency of chronic GVHD - slower recovery and lower rate of T/B function Artemis-deficient SCID - Female patient diagnosed with SCID at age of 5 months (failure to thrive, pneumonia due to Pneumocystis carinii and CMV infections) - Agammaglobulinemia, no B-cells, T-cells were of maternal origin - At age of 7 months, SCT from HLA-identical brother, uneventful post-transplantation course - Gradual rise in T-cells of donor origin, T-cells of mother disappeared within one year - However, no B-cell engraftment and patient remained dependent on immunoglobulin substitution “Lack of Space hypothesis” No B-cell engraftment post-SCT in B-negative SCID patients because of lack of physical space in bone marrow due to the presence of a relatively high frequency of early precursor Bcells (pro-B and pre-B-I), which are not eradicated with mild pre-SCT conditioning Van der Burg et al. Hematol 2006; 91:1705-9 Analysis of precursor B-cell compartment at diagnosis and post-SCT Average <5y (n=9) Average Diagnosis <5y (n=9) Diagnosis Post-BMT1 Post-BMT1 Post-BMT2 0% 10% 20% 30% 40% 50% 60% Post-BMT2 pro-B (CD22+CD19-) pre-B-I (CD34+CD10+CD20-) pre-B-II small (CD34-CD10+CD20+) immature B (CD34-CD10+CD20++) 0% 10% 20% pro-B (CD22+CD19-) Van der Burg et al. Hematol 2006; 91:1705-9 pre-B-II small (CD34-CD10+CD20+) 30% 40% 50% 70% 80% 90% 100% pre-B-II large (CD34-CD10+CD20-) 60% pre-B-I (CD34+CD10+CD20-) immature B (CD34-CD10+CD20++) 70% 80% 90% 100% pre-B-II large (CD34-CD10+CD20-) 380 380 02_02.fsa 02_02.fsa 02_04.fsa 02_04.fsa 385 385 Short tandem repeat (STR) analysis 390 395 390 395 2 Blue PP09 2 Blue PP09 400 400 405 405 410 410 415 415 420 420 425 425 430 430 435 435 440 440 4000 4000 3000 3000 2000 2000 1000 1000 patient 8 8 11 11 4 Blue PP10 4 Blue PP10 donor 11 11 14 14 4000 4000 3000 3000 2000 2000 1000 1000 380 380 02_02.fsa 02_02.fsa Post-SCT all pre-B-I cells of patient 385 385 390 395 390 395 2 Blue PP09 2 Blue PP09 400 400 405 405 410 410 415 415 420 420 425 425 430 430 435 435 440 440 375 380 PP01_A01_01.fsa 4000 4000 3000 3000 2000 2000 1000 1000 385 390 395 400 405 410 415 420 02_04.fsa 02_04.fsa 11 11 PP02_B01_03.fsa donor 11 11 440 Pre-B-I 11 3 Blue PP02 4000 4000 3000 3000 2000 2000 1000 1000 1500 1000 500 large Pre-B-II 14 14 8 PP03_C01_05.fsa Average <5y (n=9) 435 2000 1500 1000 500 8 4 Blue PP10 4 Blue PP10 430 1 Blue PP01 patient 8 8 425 11 14 5 Blue PP03 300 200 100 Pre-B-II small Average Diagnosis <5y (n=9) 8 PP04_D01_07.fsa 11 14 7 Blue PP04 Diagnosis Post-BMT1 400 200 Immature Post-BMT1 Post-BMT2 8 0% 10% 20% 30% 40% 50% 60% Post-BMT2 pro-B (CD22+CD19-) pre-B-I (CD34+CD10+CD20-) pre-B-II small (CD34-CD10+CD20+) immature B (CD34-CD10+CD20++) 0% 10% 20% 30% 40% 50% 70% 80% 90% 100% pre-B-II large (CD34-CD10+CD20-) 60% 70% 80% 90% 100% 11 14 Second SCT - Artemis-deficient SCID patient received a second SCT from same donor - Pre-SCT conditioning with busulphan B-cell recovery after 2nd SCT Average <5y (n=9) Diagnosis Post-BMT1 Post-BMT2 0% 10% 20% 30% 40% 50% 60% pro-B (CD22+CD19-) pre-B-I (CD34+CD10+CD20-) pre-B-II small (CD34-CD10+CD20+) immature B (CD34-CD10+CD20++) 70% 80% 90% 100% pre-B-II large (CD34-CD10+CD20-) 380 380 02_02.fsa 02_02.fsa Post-SCT2 precursor B-cells of donor origin 385 385 390 395 390 395 2 Blue PP09 2 Blue PP09 400 400 405 405 410 410 415 415 420 420 425 425 430 430 435 435 440 440 375 380 PP05_E01_09.fsa 4000 4000 3000 3000 2000 2000 1000 1000 385 390 395 400 405 410 415 420 02_04.fsa 02_04.fsa 11 11 PP06_F01_11.fsa donor 11 11 435 440 2000 1000 Pre-B-I 8 4 Blue PP10 4 Blue PP10 430 9 Blue PP05 patient 8 8 425 11 14 11 Blue PP06 4000 4000 3000 3000 2000 2000 1000 1000 4000 3000 2000 1000 Pre-B-II large 14 14 11 PP07_G01_13.fsa 14 13 Blue PP07 4000 3000 2000 1000 Pre-B-II small Average <5y (n=9) 11 PP08_H01_15.fsa Diagnosis 14 15 Blue PP08 1500 1000 500 Immature Post-BMT1 11 Post-BMT2 0% 10% 20% 30% 40% 50% 60% pro-B (CD22+CD19-) pre-B-I (CD34+CD10+CD20-) pre-B-II small (CD34-CD10+CD20+) immature B (CD34-CD10+CD20++) Van der Burg et al. Hematol 2006; 91:1705-9 70% 80% 90% 100% pre-B-II large (CD34-CD10+CD20-) 14 Conclusion B-cell recovery after stem cell transplantation of Artemisdeficient SCID requires elemination of autologous bone marrow precursor B-cells Acknowlegdements Dept. of Immunology, Erasmus MC, Rotterdam Barbara H. Barendregt Jacques J.M. van Dongen Dept. of Pediatrics and Central Hematology Laboratory , UMC-St Radboud, Nijmegen Corry M.R. Weemaes Frank Preijers Peter Hoogerbrugge