FASTA Format - University of California, Irvine
Download
Report
Transcript FASTA Format - University of California, Irvine
Introduction To Next Generation
Sequencing (NGS) Data Analysis
Jenny Wu
Genomics High Throughput Facility
UCI
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Popular RNA-Seq pipeline
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• Downstream Pathway analysis
• ChIP-Seq data analysis workflow and software
• NGS bioinformatics resources
• Summary
Why Next Generation Sequencing
One can generate hundreds of millions of short
sequences (up to 250bp) in a single run in a
short period of time with low per base cost.
• Illumina/Solexa GA II, HiSeq 2500, 3000,X
• Roche/454 FLX, Titanium
• Life Technologies/Applied Biosystems SOLiD
Reviews: Michael Metzker (2010) Nature Reviews Genetics 11:31
Quail et al (2012) BMC Genomics Jul 24;13:341.
Why Bioinformatics
Informatics
(wall.hms.harvard.edu)
Bioinformatics Challenges
in NGS Data Analysis
• “Big Data” (thousands of millions of lines long)
– Can’t do ‘business as usual’ with familiar tools
– Impossible memory usage and execution time
– Manage, analyze, store, transfer and archive huge files
• Need for powerful computers and expertise
– Informatics groups must manage compute clusters
– New algorithms and software are required and often time
they are open source Unix/Linux based.
– Collaboration of IT experts, bioinformaticians and biologists
Basic NGS Workflow
Olson et al.
NGS Data Analysis Overview
Olson et al.
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• NGS bioinformatics resources
• Summary
Terminology
Experimental Design:
• Coverage (sequencing depth): The number of nucleotides from
reads that are mapped to a given position.
• Paired-End Sequencing: Both end of the DNA fragment is
sequenced, allowing highly precise alignment.
• Multiplexed Sequencing: "barcode" sequences are added to each
sample so they can be distinguished in order to sequence large
number of samples on one lane.
Data analysis:
• Quality Score: Each called base comes with a quality score which measures
the probability of base call error.
• Mapping: Align reads to reference to identify their origin.
• Assembly: Merging of fragments of DNA in order to reconstruct the original
sequence.
• Duplicate reads: Reads that are identical. Can be identified after mapping.
• Multi-reads: Reads that can be mapped to multiple locations equally well.
What does the data look like?
Common NGS Data Formats
For a full list, go to http://genome.ucsc.edu/FAQ/FAQformat.html
File Formats
• Reference sequences, reads:
– FASTA
– FASTQ (FASTA with quality scores)
• Alignments:
– SAM (Sequence Alignment Mapping)
– BAM (Binary version of SAM)
• Features, annotation, scores:
– GFF3/GTF(General Feature Format)
– BED/BigBed
– WIG/BigWig
http://genome.ucsc.edu/FAQ/FAQformat.html
FASTA Format (Reference Seq)
FASTQ Format (Illumina Example)
Read Record
Header
Separator
(with optional
repeated
header)
Lane
Flow Cell ID
Tile
Tile
Coordinates
Barcode
@DJG84KN1:272:D17DBACXX:2:1101:12432:5554 1:N:0:AGTCAA
CAGGAGTCTTCGTACTGCTTCTCGGCCTCAGCCTGATCAGTCACACCGTT
+
BCCFFFDFHHHHHIJJIJJJJJJJIJJJJJJJJJJIJJJJJJJJJIJJJJ Read Bases
@DJG84KN1:272:D17DBACXX:2:1101:12454:5610 1:N:0:AG
AAAACTCTTACTACATCAGTATGGCTTTTAAAACCTCTGTTTGGAGCCAG
Read Quality
+
Scores
@@@DD?DDHFDFHEHIIIHIIIIIBBGEBHIEDH=EEHI>FDABHHFGH2
@DJG84KN1:272:D17DBACXX:2:1101:12438:5704 1:N:0:AG
CCTCCTGCTTAAAACCCAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTC
+
CCCFFFFFHHGHHJIJJJJJJJI@HGIJJJJIIIJGIGIHIJJJIIIIJJ
@DJG84KN1:272:D17DBACXX:2:1101:12340:5711 1:N:0:AG
GAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGG
+
CCCFFFFFHHHHHGGIJJJIJJJJJJIJJIJJJJJGIJJJHIIJJJIJJJ
NOTE: for paired-end runs, there is a second file
with one-to-one corresponding headers and reads.
(Passarelli, 2012)
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
General Data Pipeline
Why QC?
Sequencing runs cost money
• Consequences of not assessing the Data
• Sequencing a poor library on multiple
runs – throwing money away!
Data analysis costs money and time
•
•
•
•
Cost of analyzing data, CPU time $$
Cost of storing raw sequence data $$$
Hours of analysis could be wasted $$$$
Downstream analysis can be incorrect.
How to QC?
$ module load fastqc
$ fastqc s_1_1.fastq;
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/, available on HPC
Tutorial : http://www.youtube.com/watch?v=bz93ReOv87Y
FastQC: Example
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Premade Genome Sequence
Indexes and Annotation
http://ccb.jhu.edu/software/tophat/igenomes.shtml
The UCSC Genome Browser Homepage
General information
Get genome annotation here!
Get reference sequences here!
Specific information—
new features, current status, etc.
Downloading Reference Sequences
Downloading Reference Annotation
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Sequence Mapping Challenges
• Alignment (Mapping) is often the first step once
analysis-read reads are obtained.
• The task: to align sequencing reads against a known
reference.
• Difficulties: high volume of data, size of reference
genome, computation time, read length constraints,
ambiguity caused by repeats and sequencing errors.
How to choose an aligner?
• There are many short read aligners and they
vary a lot in performance(accuracy, memory
usage, speed and flexibility etc).
• Factors to consider : application, platform,
read length, downstream analysis, etc.
• Constant trade off between speed and
sensitivity (e.g. MAQ vs. Bowtie).
• Guaranteed high accuracy will take longer.
• Popular choices: Bowtie, BWA, Tophat, STAR.
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Application Specific Software
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Two Major Approaches
1. Gene or Exon level differential expression (DE):
DESeq2, EdgeR, DEXSeq…
2. Transcripts assembly :
Trinity, Velvet-Oasis, TransABySS,
Cufflinks, Scripture…
RNA-Seq Pipeline for DE
RNA-Seq: Spliced Alignment
• Some reads
will span two
different
exons
• Need long
enough reads
to be able to
reliably map
both sides
• Use a splice
aware aligner!
http://en.wikipedia.org/wiki/File:RNA-Seq-alignment.png
“Systematic evaluation of spliced alignment programs for RNA-seq data”
Nature Methods, 2013
How much sequence do I need?
• Oversimplified answer:20-50M PE/sample
(Human/Mouse)
Depends on:
– Size and complexity of transcriptome.
– Goal of experiment: DE, transcript discovery.
– Tissue type, library type, RNA quality, read length,
single-end…
RNA-Seq: Coverage
• Coverage in RNA-Seq is highly non-uniform
• Within a single exon, there are regions with
high coverage and regions with zero coverage.
• They change when the library preparation
protocol is changed.
• The binding preferences of random hexamer
primers explain them only partially.
We simply hope that this averages out over the
whole transcript !
RNA-Seq: Normalization
Gene-length bias
• Differential expression of longer genes is more significant
because long genes yield more reads
RNA-Seq normalization methods:
• Scaling factor based: Total count, upper quartile,
median, DESeq, TMM in edgeR
• Quantile, RPKM (cufflinks)
• ERCC
Normalize by gene length and by number of
reads mapped, e.g. RPKM/FPKM
(reads/fragments per kilo bases per million
mapped reads)
RNA-Seq: Differential Expression
Discrete vs. Continuous data:
Microarray florescence intensity data: continuous
Modeled using normal distribution
RNA-Seq read count data: discrete
Modeled using negative binomial distribution
Microarray software can NOT be directly used to
analyze RNA-Seq data!
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Popular RNA-Seq pipeline: Tuxedo suite, HTSeq-DESeq
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Popular RNA-Seq DE Pipeline
Pipeline 1
Pipeline 2
(The Tuxedo Protocol) (The Alternative Protocol)
Classic RNA-Seq (Tuxedo Protocol)
SAM/BAM
GTF/GFF
http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html
Classic vs. Advanced RNA-Seq workflow
1. Spliced Alignment: Tophat
$ tophat -p 8 -G genes.gtf -o C1_R1_thout ptgenome C1_R1_1.fq C1_R1_2.fq
$ tophat -p 8 -G genes.gtf -o C1_R2_thout ptgenome C1_R2_1.fq C1_R2_2.fq
$ tophat -p 8 -G genes.gtf -o C2_R1_thout ptgenome C2_R1_1.fq C2_R1_2.fq
$ tophat -p 8 -G genes.gtf -o C2_R2_thout ptgenome C2_R2_1.fq C2_R2_2.fq
http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html
2.Transcript assembly and
abundance quantification: Cufflinks
Cufflinks: a program that assembles aligned RNA-Seq
reads into transcripts, estimates their abundances, and
tests for differential expression and regulation
transcriptome-wide.
$ cufflinks -p 8 -o C1_R1_clout C1_R1_thout/ accepted_hits.bam
$ cufflinks -p 8 -o C1_R2_clout C1_R2_thout/ accepted_hits.bam
$ cufflinks -p 8 -o C2_R1_clout C2_R1_thout/ accepted_hits.bam
$ cufflinks -p 8 -o C2_R2_clout C2_R2_thout/ accepted_hits.bam
http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html
3. Final Transcriptome assembly:
Cuffmerge
$ cuffmerge -g genes.gtf -s genome.fa -p 8 assemblies.txt
$ more assembies.txt
./C1_R1_clout/transcripts.gtf
./C1_R2_clout/transcripts.gtf
./C2_R1_clout/transcripts.gtf
./C2_R2_clout/transcripts.gtf
http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html
4.Differential Expression: Cuffdiff
CuffDiff: a program that compares
transcript abundance between samples.
$ cuffdiff -o diff_out -b genome.fa -p 8 –L C1,C2 -u merged_asm/merged.gtf
./C1_R1_thout/accepted_hits.bam, ./C1_R2_thout/accepted_hits.bam
./C2_R1_thout/accepted_hits.bam, ./C2_R2_thout/accepted_hits.bam
http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html
Cufflinks and related resources
• Pachter, L. Models for transcript
quantification from RNA-Seq.arXiv
preprint arXiv:1104.3889 (2011).
• Trapnell C, Williams BA, Pertea
G, Mortazavi AM, Kwan G, van
Baren MJ, Salzberg SL, Wold B,
Pachter L.
Transcript assembly and
quantification by RNA-Seq
reveals unannotated transcripts
and isoform switching during
cell differentiation
Nature Biotechnology doi:
10.1038/nbt.1621
• Roberts A, Trapnell C, Donaghey
J, Rinn JL, Pachter L.
Improving RNA-Seq expression
estimates by correcting for
fragment bias
Genome Biology doi:10.1186/
gb-2011-12-3-r22
• Roberts A, Pimentel H, Trapnell
C, Pachter L.
Identification of novel
transcripts in annotated
genomes using RNA-Seq
Bioinformatics doi:10.1093/
bioinformatics/btr355
Alternative Pipeline with HTSeq
Tophat2,
HTSeq
DESeq2/edgeR
$ htseq-count -f bam C1_R1_thout/sorted.bam -s no –o hsc/C1_R1.counts
$ htseq-count -f bam C1_R1_thout/sorted.bam -s no –o hsc/C1_R1.counts
$ htseq-count -f bam C1_R1_thout/sorted.bam -s no –o hsc/C1_R1.counts
$ htseq-count -f bam C1_R1_thout/sorted.bam -s no –o hsc/C1_R1.counts
HTSeq Output: Gene Count Table
…
…
DESeq2
http://www.bioconductor.org/packages/2.12/bioc/html/DESeq2.html
Downstream Analysis
Pathway and functional analysis:
• Gene Ontology over representation
• Gene Set Enrichment Analysis (GSEA)
• Signaling Pathway Impact Analysis
• Software
DAVID, GSEA, WGCNA, Blast2go, topGO..
IPA, GeneGO MetaCore
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data file formats, general workflow
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Obtaining and preparing reference
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
•
•
•
•
spliced alignment, normalization, coverage, differential expression.
Tuxedo suite: Tophat/Cufflinks parameters setting, cummeRbund
Data Visualization
RNA-seq pipeline software: RobiNA, Galaxy
• ChIP-Seq data analysis workflow and software
• Open source pipeline software with Graphical User Interface
• Summary
Integrative
Genomics
Viewer
(IGV)
http://www.broadinstitute.org/igv
Available on HPC. Use ‘module load igv’ and ‘igv’
Visualizing RNA-Seq mapping with IGV
http://www.broadinstitute.org/igv/UserGuide
Integrative Genomics Viewer (IGV): high-performance genomics data
visualization and exploration.Thorvaldsdóttir H et al. Brief Bioinform. 2013
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
Galaxy: Web based platform for
analysis of large datasets
Galaxy: A platform for interactive large-scale genome analysis:
Genome Res. 2005. 15: 1451-1455
http://hpc-galaxy.oit.uci.edu/root
https://main.g2.bx.psu.edu/
Outline
• Goals : Practical guide to NGS data processing
• Bioinformatics in NGS data analysis
– Basics: terminology, data formats, general workflow etc.
– Data Analysis Pipeline
•
•
•
•
Sequence QC and preprocessing
Downloading reference sequences: query NCBI, UCSC databases.
Sequence mapping
Downstream analysis workflow and software
• RNA-Seq data analysis
• Concepts: spliced alignment, normalization, coverage, differential
expression.
• Tuxedo suite: Tophat, Cufflinks and cummeRbund
• Data visualization with Genome Browsers.
• RNA-Seq pipeline software: Galaxy vs. shell scripting
• ChIP-Seq data analysis workflow and software
• Scripting Languages and bioinformatics resources
• Summary
What is ChIP-Seq?
• Chromatin-Immunoprecipitation (ChIP)Sequencing
• ChIP - A technique of precipitating a protein
antigen out of solution using an antibody that
specifically binds to the protein.
• Sequencing – A technique to determine the order
of nucleotide bases in a molecule of DNA.
• Used in combination to study the interactions
between protein and DNA.
ChIP-Seq Applications
Enables the accurate profiling of
•
•
•
•
Transcription factor binding sites
Polymerases
Histone modification sites
DNA methylation
A View of ChIP-Seq Data
• Typically reads (35-55bp) are quite sparsely
distributed over the genome.
• Controls (i.e. no pull-down by antibody)
often show smaller peaks at the same
locations
Rozowsky et al Nature Biotech, 2009
ChIP-Seq Analysis Pipeline
Sequencin
g
Base
Calling
Read QC
Short read
Sequences
Short read
Alignment
Enriched
Regions
Visualization
with genome
browser
Differential
peaks
Motif
Discovery
Combine
with gene
expression
Peak
Calling
ChIP-Seq: Identification of Peaks
• Several methods to identify peaks but they mainly fall into 2
categories:
– Tag Density
– Directional scoring
• In the tag density method, the program searches for large clusters
of overlapping sequence tags within a fixed width sliding window
across the genome.
• In directional scoring methods, the bimodal pattern in the strandspecific tag densities are used to identify protein binding sites.
• Determining the exact binding sites from short reads generated
from ChIP-Seq experiments
– SISSRs (Site Identification from Short Sequence Reads) (Jothi 2008)
– MACS (Model-based Analysis of ChIP-Seq) (Zhang et al, 2008)
ChIP-Seq: Output
• A list of enriched locations
• Can be used:
– In combination with RNA-Seq, to determine the
biological function of transcription factors
– Identify genes co-regulated by a common
transcription factor
– Identify common transcription factor binding
motifs
Resources in NGS data analysis
• Stackoverflow.com
Summary
• NGS technologies are transforming
molecular biology.
• Bioinformatics analysis is a crucial part in
NGS applications
– Data formats, terminology, general workflow
– Analysis pipeline
– Software for various NGS applications
•
•
•
•
RNA-Seq and ChIP-Seq data analysis
Pathway Analysis
Data visualization
Bioinformatics resources
Thank you!