Minimal Residual Disease analysis in childhood ALL

Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab

Survival in Childhood ALL

Prognostic factors used to direct therapy

 Fixed factors  Age, sex, white cell count at diagnosis, cytogenetics  Dynamic factors  response to treatment correlates with prognosis • slow early response (SER) assessed by microscopy predicts relapse • predicts outcome within groups of children with the same fixed risk factors receiving the same therapy • BUT the microscope is an insensitive tool for detection of residual leukaemia and most destined to relapse have a rapid response

Analysis of outcome for MRC UKALL 97/99 Trial Stratification of Treatment based on “clinical risk”

Intensity of Therapy

Treatment Arm A Arm B Arm C Characteristics <10 yrs AND WCC <50 AND RER >10 yrs or WCC >50 AND RER A or B AND SER Or poor cytos N 62 22 16

Analysis of outcome for MRC UKALL 97/99 Trial Stratification of Treatment based on “clinical risk”

Intensity of Therapy

Treatment Arm A Arm B Arm C Characteristics <10 yrs AND WCC <50 AND RER >10 yrs or WCC >50 AND RER A or B AND SER Or poor cytos N 62 22 16 EFS (%) 84 70 70

Analysis of outcome for MRC UKALL 97/99 Trial Stratification of Treatment based on “clinical risk”

Intensity of Therapy

Treatment Arm A Arm B Arm C Characteristics <10 yrs AND WCC <50 AND RER >10 yrs or WCC >50 AND RER A or B AND SER Or poor cytos N 62 22 16 EFS (%) Relapse 84 11 (52%) 70 70 6 (28%) 4 (20%) Only 20% of relapse comes from highest risk group Many of those cured are over-treated

10 12 10 11

Minimal Residual Disease

MRD Relapse Detection limit of cytomorphology Haematologic remission 10 7 0 MRD Analysis Detection limit of PCR technique “cure” Follow-up In years

Prognostic value of MRD

MRD shown to have independent prognostic value in ALL  Childhood ALL    van Dongen

et al

1998 Cav é

et al

1998 Coustan-Smith

et al

1998  Relapsed childhood ALL  Knechtli

et al

1998   Eckert

et al

2001 Goulden

et al

2003  Adult ALL   Bruggeman

et al

2006 Raff

et al

2007

van Dongen

et al

, Lancet 1998

= 98% = 78% = 20%

Quantitative MRD Detection

Three methods currently available : 1.

Flow cytometric immunophenotyping  Utilises tumour associated aberrant immunophenotypes • E.g. Presence of myeloid markers on leukaemia blasts 2.

Reverse transcriptase (RT) PCR  Utilises tumour specific RNA targets • E.g. Fusion gene transcripts 3.

Real-time Quantitative (RQ) PCR  Utilises patient-specific gene rearrangements • E.g. Immunoglobulin and T-cell receptor gene rearrangements  Utility of method chosen depends upon the aim of the study  Important considerations: applicability, stability, sensitivity & quantitation  RQ-PCR methodology is method of choice in most European MRD-based clinical trials

RQ-PCR for MRD analysis

 Methodology identifies unique Immunoglobulin and/or T-cell receptor gene rearrangements that are clone-specific  98% of patients will have at least one clonal rearrangement  Two patient-specific RQ-PCR assays are designed for each patient  capable of detecting one leukaemic cell in a background of 10,000 marrow cells • Important to prevent false-negative results due to clonal evolution  80-85% of patients will have two assays quantitative to 1 in 10,000

Scheme of Investigation -

identification of patient-specific MRD marker  PCR analysis of diagnostic DNA  Heteroduplex analysis of PCR products  Purify and sequence clonal rearrangement • Identification of V, D and J segment usage  Synthesis of 18 - 25 base patient-specific oligonucleotide

D region N region J region

TTGTAGTAGTTACCAGCT GGGCTA TGAATACTTCCAGCACTGGG  In Patient-specific RQ-PCR for MRD Analysis

ALL2003 Randomisation Algorithm

UKMRD Laboratory Network Glasgow

Glasgow

Aberdeen Belfast Dublin Dundee Edinburgh Liverpool Newcastle

Bristol

Cardiff Leeds Oxford Southampton

Bristol

Sheffield

Birmingham Derby Leicester Manchester Nottingham Norwich Sheffield

Barts & Royal London

Great Ormond Street Middlesex Royal Marsden St Georges University College University Hospital Cambridge Barts

MRD risk groups by Regimen - January 2009

Regimen A Regimen B Characteristics <10 yrs AND WCC <50 AND RER >10 yrs or WCC >50 AND RER Total Registered 947 637 1584 MRD High risk 264 (28%) 214 (34%) 478 (30%) MRD Low risk 288 (30%) 155 (24%) 443 (28%)

Event Free Survival By Trial

100 75 50 25 0 0 At risk: ALL97 (1997-99) 997 ALL97-99 (1999-2002) 938 ALL2003 (2003-) 1828 1 919 889 1368 ALL2003 ( 2003 )

88%

ALL97-99 (1999-2002)

80% 74%

ALL97 (1997-99) 2 TIME IN YEARS 3 865 849 967 801 814 551 4 757 769 201 5 732 745 0

Relapse Risk By Trial

ALL PATIENTS 100 75 50 ALL97-99 (1999-2002) ALL2003 (2003-) No.

Patients 932 1839 No.

Events 162 70 2P = 0·0001 Obs./ Exp.

1·2 0·7 25 0 0 At risk: ALL97-99 (1999-2002) 932 ALL2003 (2003-) 1819 1 889 1368 2 3 848 953 TIME IN YEARS 814 551 ALL97-99 (1999-2002) ALL2003 (2003-) 4 769 201 16% 8% 5 744 0

Event Free Survival by MRD Risk Group

100 75 LOW = 95% INDETERMINATE = 85% HIGH = 78% 50 25 0 0 At risk: HIGH LOW INDETERMINATE 638 604 738 HIGH LOW INDETERMINATE No.

Patients 638 604 738 No.

Events 68 12 70 Obs./ Exp.

1·5 0·3 1·2 1 451 467 566 2 TIME IN YEARS 3 317 311 449 187 184 307 4 5 68 89 161 15-JAN-09 17:51:15 0 3 7

Proposals for ALL 2010

 All patients on ALL 2020 will have therapy allocated based on MRD • Treatment on ALL 2003 is currently randomised based on MRD  Including risk groups A, B and C  MRD Analysis done at day 28 and week 11  Sequential analysis of High Risk disease at 2 or 3 extra time-points  Identification of patients with Very High Risk disease • Novel therapies employed • BMT?



Acknowledgements

Members of UKMRD network: Barts

Gary Wright Maggie Corbo Sheela Medahunsi

Ulrika Johannson Susannah Akiki

 

Clinical Co-ordinator: -

Nick Goulden

Bristol Glasgow

Jerry Hancock Paul Archer Richard Hathway Kayleigh McDonagh Paula Waits

Nigel Wood

Sandra Chudleigh Mary Gardiner Frances Fee Linda Smith

Nicola Craig Anne Sproul Steve McKay

UKMRD Steering Committee:-

Nick Cross Ajay Vora Brenda Gibson David Grant Christine Harrison Finbarr Cotter John Moppett

CLWP and ALL Task Force ESG-MRD-ALL

:-

I-BFM MRD Group

Jacques van Dongen Vincent van der Velden

Sheffield

Gill Wilson Helen Stuart Shilpa Haridas

Amal Afifi Miranda Durkie Jane Holden Richard Kirk James Blackburn

  