Transcript Document
Bioinformatics – a Definition The field of science in which biology, computer science, and information technology merge into a single discipline. NCBI, Aug 2001 BIOLOGY BIO INFORMATICS COMPUTER SCIENCE INFORMATION TECHNOLOGY Biology in the 21st century is being transformed from a purely lab-based science to an information science as well. www.genomics.org.cn:8080/bgi/bgilt/ images/bioinformatics.jp Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. Growth of Bioinformatics Computer Programming 50 yrs ago Personal Computers/ Internet 20 yrs ago w.w.w. All fields use computers (art, law, communication) DNA & Protein Structure PCR Last 10 yrs Human Genome Project Now Global Biological Research Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001 Gene a b c d e …ATGGCCCTGTGGATGCGCCTCCTGCCCCTG….. DNA base sequence recipe for amino acids Met: Ala: Leu: Trp: Met: Arg: Leu: Leu: Pro: Leu: Amino acid sequence = protein = trait Art by Yelena Ponirovskaya Why use Bioinformatics? Data mining requires a testable hypothesis generated with regard to the function or structure of a gene or protein by identifying similar sequences in better characterized organisms. To help in uncovering phylogenetic relationships and evolutionary patterns. www.tigr.org DNA ATGCATTTCGGT TTACGCCATATA GCTCGGGAATCA TGCATCGATCGA GTAGCTAGCTAG Model organisms Protein PNSADADNDFEDRL RAGLCDHDKEVQGL QVRCAVUEEHMHK KQQEFENIRLDAQRL EFFAYIFQKEHMKR What is Bioinformatics? TGT ATT AGA ACA ATA TGT GCA ATT AAT ATA CAT TGG AAT AAT GTA ATA AGT AAT CAT CTT CCT AGT AGT AAT TAT TGT AAA TTT ACG TAT ACC TGT ATT GTT TTT AAC AAT GTT GTT GTT TGT ATT AGA ACA ATA TGT GCA ATT AAT ATA CAT TGG AAT AAT GTA ATA AGT AAT CAT CTT CCT AGT AGT AAT TAT TGT AAA TTT ACG TAT ACC TGT ATT GTT TTT AAC AAT GTT GTT GTT TTC TGT AAA CTG ATT ATT TGT CTG TTC TGT AAA CTG ATT ATT TGT CTG Which genes are turned off then on ? Courtesy of Dr. Young Moo Lee UC Davis What’s in a name? Genome Mapping Multiple Sequence Alignment Database Homology Searching Sequence Analysis Protein Analysis Proteomics Bio Informatics Sample Registration & Tracking 3D Modeling Homology Modeling Docking Intellectual Property Auditing Integrated Data Repositories Common Visual Interfaces Illustration from SWBIC's Bioinformatics: Molecular Biology and Computational Science workshop held October 21-23, 1999. http://www.swbic.org Set of tools for all areas of science Genetic Blueprints Human Genome Project DNA Sequencing DNA Fingerprinting DNA Protein interaction What is Bioinformatics? N. M. Luscombe, et al. Yale University Method Inform Med 4/2001 Onconomics Corporation Fictitious Biotechnology Company Onconomics Corporation http://www.bscs.org/onco/default.htm Sequencing Projects External Links Glossary From nonprofit BSCS Biological Sciences Curriculum Study Onconomics Corporation Employment Opportunities at Onconomics Corporation Bioinformatics Technician – responsible for creation and use of software for the display and manipulation of data for genome sequencing projects. Position requires a Bachelor’s degree in molecular biology and experience with PERL and Java programming languages. Salary to $45,000 with excellent benefits. Bioinformatics Analyst – responsible for supporting the company’s gene indices of sequencing projects. Position requires a Bachelor’s or Master’s degree in the biological sciences. Familiarity with SQL language, Unix, PERL and programming tools preferred. Salary to $55,000 with excellent benefits. Bioinformatics Scientist – responsible for creating and applying new software for the development of new drugs. Requires a Ph.D. in molecular biology or related field, as well as an advanced degree in Information Technology. Salary to $100,000 with excellent benefits Onconomics Corporation Sample Electropherograms Normal Sequence: Heterozygous Base: Unreadable Region: Visualization in Science NCBI Problem Sets http://www.ncbi.nlm.nih.gov/Class/FieldGuide/problem_set.html The last known Tasmanian tiger died in the Hobart Zoo in 1936. DNA sequences have been obtained from museum specimens. How many DNA and protein sequences are there? What genes were cloned? There are a number of sequences for extinct organisms in the NCBI databases. Visit the list of extinct taxa in the Taxonomy Browser pages. http://www.swbic.org/products/clipart/clipart.php