Lecture 2

Transcript Lecture 2

The Human Genome Project – Part 2

BLT/ Topic 1 Pt 2/Apr 2012

Your assignment for last week…

• • • • Group 1 and 2 – explain the following terms related to genome sequencing: 1: mapping, STSs and ESTs, coverage, contigs, golden tiling path, 2: library, BACs, finishing, annotation Group 3 – explain the hierarchical approach Group 4 – explain the whole genome shotgun approach

http://www.yourgenome.org/teachers/bac.shtml

http://www.dnalc.org/resources/animations/ http://bcs.whfreeman.com/thelifewire/content/chp17/1702002.html

http://www.dnaftb.org/39/ 3

Background

• • Field of ▫ genomics began with decision to sequence human genome Size of human genome is 3 billion base pairs, which necessitated new ways to do sequencing Approaches to sequencing the human genome ▫ Scale up existing techniques ▫ ▫ Develop new sequencing techniques Start with smaller genomes used as a warm-up project

Whole-genome shotgun sequencing I

• • • • Developed by Celera ▫ Subsidiary of Applied Biosystems, maker of automated sequencers No mapping Instead, the whole genome is sheared Randomly sequenced © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Generate tens of millions of sequence reads Assemble 6

Whole-genome shotgun sequencing III

7 • • • Major challenge: assembly ▫ Repetitive elements are the biggest problem Performed on very high-speed computers, using novel software Key to assembly is paired reads ▫ Sequence both ends of each clone

Map-based sequencing I

• ▫ ▫ ▫ Human Genome Project adopted a map-based strategy ▫ Start with well-defined physical map Produce shortest tiling path for large-insert clones Assemble the sequence for each clone Then assemble the entire sequence, based on the physical map

Map based sequencing Steps in genomic sequencing

• • • Library making ▫ Large-insert library from genome ▫ ▫ Production sequencing ▫ ▫ Generate fragments to be sequenced Perform sequencing reactions ▫ Determine sequence Finishing Assemble into continuous sequence Fill gaps 9

Map based sequencing Library making

• • • Library of genomic fragments made in vector ▫ BAC – Bacterial artificial chromosome ▫ Usually have several-fold coverage  Every DNA sequence on five to eight different clones Difficult and inefficient to sequence straight from large fragment Need to break into manageable pieces ▫ Random shearing  By nebulization or sonication

Fragments for sequencing

• • Generally use 2–10 kb pieces for sequencing Clone into sequencing vector ▫ Contains binding sites for sequencing primers © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Pros and cons of large-insert vectors

• • Lambda phage and cosmids ▫ ▫ Inserts stable But insert size too small for large-scale sequencing projects YACs ▫ ▫ Largest insert size But difficult to work with © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

BACs and PACs

• BACs and PACs ▫ ▫ ▫ Most commonly used vectors for large-scale sequencing Good compromise between insert size and ease of use Growth and isolation similar to that for plasmids © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Contigs

• • Contigs are groups of overlapping pieces of chromosomal DNA ▫ Make contiguous clones For sequencing one wants to create “minimum tiling path” ▫ Contig of smallest number of inserts that covers a region of the chromosome genomic DNA contig minimum tiling path © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Physical mapping

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 • • • Restriction mapping (by restriction endonucleases) STS (Sequence tag site) mapping FISH – fluorescence in-situ hybridisation 15

Finishing I

• • Process of assembling raw sequence reads into accurate contiguous sequence ▫ Required to achieve 1/10,000 accuracy Manual process ▫ Look at sequence reads at positions where programs can’t tell which base is the correct one ▫ Fill gaps ▫ Ensure adequate coverage Gap Single stranded © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Finishing II

• • To fill gaps in sequence, design primers and sequence from primer To ensure adequate coverage, find regions where there is not sufficient coverage and use specific primers for those areas Primer GAP Primer © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Verification

• • Region verified for the following: ▫ Coverage ▫ Sequence quality ▫ Contiguity Determine restriction-enzyme cleavage sites ▫ Generate restriction map of sequenced region ▫ Must agree with fingerprint generated of clone during mapping step

Sequencing coverage

• • Coverage is the number of times the same region is sequenced ▫ Ideally, one wants an equal number of sequences in each direction To obtain accuracy of one error in 10,000 bases, one needs the following: ▫ 10 x coverage  Stringent finishing ▫ Complete sequence  Base-perfect sequencing

Map-based sequencing II

23 © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Construct clone map and select mapped clones Generate several thousand sequence reads per clone Assemble

Why map before sequencing?

• • Major problem in large-scale sequencing: ▫ Current technologies can only sequence 600–800 bases at a time One solution: make a physical map of overlapping DNA fragments ▫ Determine sequence of each fragment ▫ Then assemble to form contiguous sequence

Controversy: Map-based sequencing vs. whole-genome shotgun sequencing

• • • Celera used publicly funded sequence to produce its published draft of the human genome Scientists who worked on the map-based effort claimed Celera couldn’t have produced a draft without access to the public sequence Celera scientists claim that they could have produced an accurate draft even without the public sequence

Hybrid approach

• • ▫ ▫ ▫ Combines aspects of both map-based and whole genome shotgun approaches ▫ Map clones Sequence some of the mapped clones Do whole-genome sequencing Combine information from both methods  Use sequence from mapped clones as scaffold to assemble whole-genome shotgun reads Used for sequencing the mouse genome

Sequence annotation

• • Annotation performed on completed sequence Computer programs used to find the following: ▫ Genes ▫ Exons and introns ▫ Regulatory sequences ▫ Repetitive elements © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Industrialization of sequencing

• • • Most large-scale sequencing projects divide tasks among different teams ▫ Large-insert libraries ▫ Production sequencing ▫ Finishing Sequencing machines run 24/7 Many tasks performed by robots © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

More about Mapping!

• • • • • Genetic mapping Physical mapping Chromosome walking Determining DNA sequences New techniques for mapping and sequencing

Mapping I

• • Mapping is identifying relationships between genes on chromosomes ▫ Just as a road map shows relationships between towns on highway Two types of mapping: genetic and physical © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Mapping II

Genetic mapping ▫ Based on differences in recombination frequency between genetic loci • Physical mapping ▫ Based on distances in base pairs between specific sequences found on the chromosome • Most powerful when genetic and physical mapping are combined

Genetic mapping I

• • Based on recombination frequencies ▫ The further away two points are on a chromosome, the more recombination there is between them Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci

Genetic mapping II

• • Genetic mapping requires that a cross be performed between two related organisms ▫ The organism should have phenotypic differences resulting from allele differences at two or more loci The frequency of recombination is determined by counting the F 2 progeny with each phenotype

Genetic mapping example I

• Genes on two different chromosomes ▫ Independent assortment during meiosis ▫ No linkage

F 1 9 : 3 : 3 : 1

Genetic mapping example II

• Genes very close together on same chromosome ▫ Will usually end up together after meiosis ▫ Tightly linked

F 1 1 : 2 : 1

Genetic mapping example III

• Genes on same chromosome, but not very close together ▫ Recombination will occur ▫ Frequency of recombination proportional to distance between genes ▫ Measured in centiMorgans recombinants © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Genetic markers

• Genetic mapping between positions on chromosomes ▫ Positions can be genes  Responsible for phenotype  Examples: eye color or disease trait ▫ Positions can be physical markers  DNA sequence variation

Physical mapping

• • Determination of physical distance between two points on chromosome ▫ Distance in base pairs Physical markers are DNA sequences that vary between two related genomes  Referred to as a DNA polymorphism  Usually not in a gene ▫ Examples    RFLP SSLP SNP

RFLP

• Restriction-fragment length polymorphism ▫ Cut genomic DNA from two individuals with restriction enzyme ▫ Run Southern blot ▫ Probe with different pieces of DNA ▫ Sequence difference creates different band pattern

1 2

GGATCC CCTAGG 200 GTATCC GATAGG 400 GGATCC CCTAGG GGATCC CCTAGG 200

GCATCC GGTAGG

400 GGATCC CCTAGG 600 400 200

1 * 2 *

SSLP

• • • • • Simple-sequence length polymorphism Most genomes contain repeats of three or four nucleotides Length of repeat varies Use PCR with primers external to the repeat region On gel, see difference in length of amplified fragment

1 2 1

ATCCTACGACGACGACGATTGATGCT

SNP

• Single-nucleotide polymorphism ▫ One-nucleotide difference in sequence of two organisms ▫ Found by sequencing ▫ Example: Between any two humans, on average one SNP every 1,000 base pairs

1 2

ATCGATTGCCATGAC ATCGATGGCCATGAC

SNP

Expressed Sequence Tags (EST)

• • Idea: sequence only “important” genes ▫ Those genes expressed in a particular tissue Sequence random cDNAs made from RNA extracted from tissue of interest Muscle cDNA libraries “New” Biolims mRNA Robotized stations DNA sequencers © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

EST sequencing II

• • • • Make cDNA library Select clones at random Sequence in from one or both ends ▫ One-pass sequencing The resulting sequence = expressed sequence tag (EST) 5’ cDNA 3’ Partial sequence = EST © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

EST sequencing: pros and cons

• Advantages ▫ Relatively inexpensive ▫ Certainty that sequence comes from transcribed gene ▫ Information about tissue and developmental stage • Disadvantages ▫ No regulatory information ▫ Usually less than 60% of genes found in EST collections ▫ Location of sequence in genome unknown

Lecture 2

Transcript Lecture 2

The Human Genome Project – Part 2

BLT/ Topic 1 Pt 2/Apr 2012

Your assignment for last week…

Background

Whole-genome shotgun sequencing I

Whole-genome shotgun sequencing III

Map-based sequencing I

Map based sequencing Steps in genomic sequencing

Map based sequencing Library making

Fragments for sequencing

Pros and cons of large-insert vectors

BACs and PACs

Contigs

Physical mapping

Finishing I

Finishing II

Verification

Sequencing coverage

Map-based sequencing II

Why map before sequencing?

Controversy: Map-based sequencing vs. whole-genome shotgun sequencing

Hybrid approach

Sequence annotation

Industrialization of sequencing

More about Mapping!

Mapping I

Mapping II

Genetic mapping I

Genetic mapping II

Genetic mapping example I

Genetic mapping example II

Genetic mapping example III

Genetic markers

Physical mapping

RFLP

SSLP

SNP

Expressed Sequence Tags (EST)

EST sequencing II

EST sequencing: pros and cons

Directory